Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparison of AutoSetä and polysomnography for the detection of apnea-hypopnea events

The use of the flow vs time relationship obtained with the nasal prongs of the AutoSetä (AS) system (diagnosis mode) has been proposed to detect apneas and hypopneas in patients with reasonable nasal patency. Our aim was to compare the accuracy of AS to that of a computerized polysomnographic (PSG) system. The study was conducted on 56 individuals (45 men) with clinical characteristics of obstructive sleep apnea (OSA). Their mean (± SD) age was 44.6 ± 12 years and their body mass index was 31.3 ± 7 kg/m2. Data were submitted to parametric analysis to determine the agreement between methods and the intraclass correlation coefficient was calculated. The Student t-test and Bland and Altman plots were also used. Twelve patients had an apnea-hypopnea index (AHI) <10 in bed and 20 had values >40. The mean (± SD) AHI PSG index of 37.6 (28.8) was significantly lower (P = 0.0003) than AHI AS (41.8 (25.3)), but there was a high intraclass correlation coefficient (0.93), with 0.016 variance. For a threshold of AHI of 20, AS showed 73.0% accuracy, 97% sensitivity and 60% specificity, with positive and negative predictive values of 78% and 93%, respectively. Sensitivity, specificity and negative predictive values increased in parallel to the increase in AHI threshold for detecting OSA. However, when the differences of AHI PSG-AS were plotted against their means, the limits of agreement between the methods (95% of the differences) were +13 and -22, showing the discrepancy between the AHI values obtained with PSG and AS. Finally, cubic regression analysis was used to better predict the result of AHI PSG as a function of the method proposed, i.e., AHI AS. We conclude that, despite these differences, AHI measured by AutoSetä can be useful for the assessment of patients with high pre-test clinical probability of OSA, for whom standard PSG is not possible as an initial step in diagnosis.

Detection of genetically modified maize events in Brazilian maize-derived food products

The Brazilian government has approved many transgenic maize lines for commercialization and has established a threshold of 1% for food labeling, which underscores need for monitoring programs. Thirty four samples including flours and different types of nacho chips were analyzed by conventional and real-time PCR in 2011 and 2012. The events MON810, Bt11, and TC1507 were detected in most of the samples, and NK603 was present only in the samples analyzed in 2012. The authorized lines GA21, T25, and the unauthorized Bt176 were not detected. All positive samples in the qualitative tests collected in 2011 showed a transgenic content higher than 1%, and none of them was correctly labeled. Regarding the samples collected in 2012, all positive samples were quantified higher than the threshold, and 47.0% were not correctly labeled. The overall results indicated that the major genetically modified organisms detected were MON810, TC1507, Bt11, and NK603 events. Some industries that had failed to label their products in 2011 started labeling them in 2012, demonstrating compliance with the current legislation observing the consumer rights. Although these results are encouraging, it has been clearly demonstrated the need for continuous monitoring programs to ensure consumers that food products are labeled properly.

Sensitive and selective detection of free FXIII activation peptide: a potential marker of acute thrombotic events

Coagulation factor XIII (FXIII) stabilizes fibrin fibers and is therefore a major player in the maintenance of hemostasis. FXIII is activated by thrombin resulting in cleavage and release of the FXIII activation peptide (AP-FXIII). The objective of this study was to characterize the released AP-FXIII and determine specific features that may be used for its specific detection. We analyzed the structure of bound AP-FXIII within the FXIII A-subunit and interactions of AP-FXIII by hydrogen bonds with both FXIII A-subunit monomers. We optimized our previously developed AP-FXIII ELISA by using 2 monoclonal antibodies. We determined high binding affinities between the antibodies and free AP-FXIII and demonstrated specific binding by epitope mapping analyses with surface plasmon resonance and enzyme-linked immunosorbent assay. Because the structure of free AP-FXIII had been characterized so far by molecular modeling only, we performed structural analysis by nuclear magnetic resonance. Recombinant AP-FXIII was largely flexible both in plasma and water, differing significantly from the rigid structure in the bound state. We suggest that the recognized epitope is either occluded in the noncleaved form or possesses a structure that does not allow binding to the antibodies. On the basis of our findings, we propose AP-FXIII as a possible new marker for acute thrombotic events.

Early Detection of Emergent Events Based on an Extremal Process Approach

2000 Mathematics Subject Classification: Primary 60G70, 62F03.

Direct detection of Kaluza-Klein particles in neutrino telescopes

In theories with universal extra dimensions, all standard model fields propagate in the bulk and the lightest state of the first Kaluza-Klein (KK) level can be made stable by imposing a Z(2) parity. We consider a framework where the lightest KK particle (LKP) is a neutral, extremely weakly interacting particle such as the first KK excitation of the graviton, while the next-to-lightest KK particle (NLKP) is the first KK mode of a charged right-handed lepton. In such a scenario, due to its very small couplings to the LKP, the NLKP is long-lived. We investigate the production of these particles from the interaction of high energy neutrinos with nucleons in the Earth and determine the rate of NLKP events in neutrino telescopes. Using the Waxman-Bahcall limit for the neutrino flux, we find that the rate can be as large as a few hundreds of events a year for realistic values of the NLKP mass.

Myocarditis in children and detection of viruses in myocardial tissue: Implications for immunosuppressive therapy

Background: There is scarce information on the potential benefits of immunosuppression in children with myocarditis and viral genomes in myocardium. We investigated the occurrence of myocarditis in children with a preliminary diagnosis of dilated cardiomyopathy, the frequency of cardiotropic viruses in the myocardium, and the response to immunosuppression. Methods: Thirty patients (nine months to 12 years) with left ventricular ejection fraction of 22.8 +/- 4.1% were subjected to right cardiac catheterization and endomyocardial biopsy. Specimens were analyzed for the presence of inflammatory elements (Dallas criteria) and viral genome (polymerase chain reaction). Patients with active myocarditis received immunosuppressants (azatioprine and prednisone) and were recatheterized nine months later. A historical control group of nine patients with myocarditis who did not receive immunosuppressants was included. Results: Active myocarditis was diagnosed in ten patients (five with viral genomes detected). Immunosuppression resulted in a significant increase in left ventricular ejection fraction from 25.2 +/- 2.8% to 45.7 +/- 8.6% (versus 20.0 +/- 4.0% to 22.0 +/- 9.0% in historical controls, p < 0.01) and cardiac index from 3.28 +/- 0.51 L/min/m(2) to 4.40 +/- 0.49 L/min/m(2) (versus 3.50 +/- 0.40 L/min/m(2) to 3.70 +/- 0.50 L/min/m(2) in controls, p < 0.01), regardless of the presence of viral genomes (p - 0.98 and p - 0.22, respectively for the two variables). No relevant clinical events were observed. Non-inflammatory cardiomyopathy was diagnosed in 20 patients (seven with viral genomes). While on conventional therapy, there were four deaths and three assignments to transplantation, and no improvement of left ventricular ejection fraction in the remaining ones (22.5 +/- 3.6% to 27.5 +/- 10.6%). Conclusion: Children with chronic myocarditis seem to benefit from immunosuppressive therapy, regardless of the presence of viral genome in the myocardium. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Noninvasive measurement of cerebral bioimpedance for detection of cerebral edema in the neonatal piglet

The association of sustained cerebral edema with poor neurological outcome following hypoxia-ischaemia in the neonate suggests that measurement of cerebral edema may allow early prediction of outcome in these infants. Direct measurements of cerebral impedance have been widely used in animal studies to monitor cerebral edema, but such invasive measurements are not possible in the human neonate. This study investigated the ability of noninvasive cerebral impedance measurements to detect cerebral edema following hypoxia-ischaemia. One-day-old piglets were anaesthetized, intubated and ventilated. Hypoxia was induced by reducing the inspired oxygen concentration to 4-6% O-2. Noninvasive cerebral bioimpedance was measured using gel electrodes attached to the scalp. Cerebral bioimpedance was also measured directly by insertion of two silver-silver chloride electrodes subdurally. Noninvasive and invasive measurements were made before, during and after hypoxia. Whole body impedance was measured to assess overall fluid movements. Intracranial pressure was measured continuously via a catheter inserted subdurally, as an index of cerebral edema. There was good agreement between noninvasive and invasive measurements of cerebral impedance although externally obtained responses were attenuated. Noninvasive measurements were also well correlated with intracranial pressure. Whole body impedance changes did not account for increases in noninvasively measured cerebral impedance. Results suggest that noninvasive cerebral impedance measurements do reflect intracranial events, and are able to detect cerebral edema following hypoxia-ischaemia in the neonate. (C) 2002 Elsevier Science B.V. All rights reserved.

Methodological framework for detection of harmonisation breaking in service environments

As the complexity of markets and the dynamicity of systems evolve, the need for interoperable systems capable of strengthening enterprise communication effectiveness increases. This is particularly significant when it comes to collaborative enterprise networks, like manufacturing supply chains, where several companies work, communicate, and depend on each other, in order to achieve a specific goal. Once interoperability is achieved, that is once all network parties are able to communicate with and understand each other, organisations are able to exchange information along a stable environment that follows agreed laws. However, as markets adapt to new requirements and demands, an evolutionary behaviour is triggered giving space to interoperability problems, thus disrupting the sustainability of interoperability and raising the need to develop monitoring activities capable of detecting and preventing unexpected behaviour. This work seeks to contribute to the development of monitoring techniques for interoperable SOA-based enterprise networks. It focuses on the automatic detection of harmonisation breaking events during real-time communications, and strives to develop and propose a methodological approach to handle these disruptions with minimal or no human intervention, hence providing existing service-based networks with the ability to detect and promptly react to interoperability issues.

MR-IMPACT II: Magnetic Resonance Imaging for Myocardial Perfusion Assessment in Coronary artery disease Trial: perfusion-cardiac magnetic resonance vs. single-photon emission computed tomography for the detection of coronary artery disease: a comparative multicentre, multivendor trial.

Aims Perfusion-cardiac magnetic resonance (CMR) has emerged as a potential alternative to single-photon emission computed tomography (SPECT) to assess myocardial ischaemia non-invasively. The goal was to compare the diagnostic performance of perfusion-CMR and SPECT for the detection of coronary artery disease (CAD) using conventional X-ray coronary angiography (CXA) as the reference standard. Methods and results In this multivendor trial, 533 patients, eligible for CXA or SPECT, were enrolled in 33 centres (USA and Europe) with 515 patients receiving MR contrast medium. Single-photon emission computed tomography and CXA were performed within 4 weeks before or after CMR in all patients. The prevalence of CAD in the sample was 49%. Drop-out rates for CMR and SPECT were 5.6 and 3.7%, respectively (P = 0.21). The primary endpoint was non-inferiority of CMR vs. SPECT for both sensitivity and specificity for the detection of CAD. Readers were blinded vs. clinical data, CXA, and imaging results. As a secondary endpoint, the safety profile of the CMR examination was evaluated. For CMR and SPECT, the sensitivity scores were 0.67 and 0.59, respectively, with the lower confidence level for the difference of +0.02, indicating superiority of CMR over SPECT. The specificity scores for CMR and SPECT were 0.61 and 0.72, respectively (lower confidence level for the difference: -0.17), indicating inferiority of CMR vs. SPECT. No severe adverse events occurred in the 515 patients. Conclusion In this large multicentre, multivendor study, the sensitivity of perfusion-CMR to detect CAD was superior to SPECT, while its specificity was inferior to SPECT. Cardiac magnetic resonance is a safe alternative to SPECT to detect perfusion deficits in CAD.

Detection of HIV drug resistance during antiretroviral treatment and clinical progression in a large European cohort study.

OBJECTIVE(S): To investigate the relationship between detection of HIV drug resistance by 2 years from starting antiretroviral therapy and the subsequent risk of progression to AIDS and death. DESIGN: Virological failure was defined as experiencing two consecutive viral loads of more than 400 copies/ml in the time window between 0.5 and 2 years from starting antiretroviral therapy (baseline). Patients were grouped according to evidence of virological failure and whether there was detection of the International AIDS Society resistance mutations to one, two or three drug classes in the time window. METHODS: Standard survival analysis using Kaplan-Meier curves and Cox proportional hazards regression model with time-fixed covariates defined at baseline was employed. RESULTS: We studied 8229 patients in EuroSIDA who started antiretroviral therapy and who had at least 2 years of clinical follow-up. We observed 829 AIDS events and 571 deaths during 38,814 person-years of follow-up resulting in an overall incidence of new AIDS and death of 3.6 per 100 person-years of follow-up [95% confidence interval (CI):3.4-3.8]. By 96 months from baseline, the proportion of patients with a new AIDS diagnosis or death was 20.3% (95% CI:17.7-22.9) in patients with no evidence of virological failure and 53% (39.3-66.7) in those with virological failure and mutations to three drug classes (P = 0.0001). An almost two-fold difference in risk was confirmed in the multivariable analysis (adjusted relative hazard = 1.8, 95% CI:1.2-2.7, P = 0.005). CONCLUSION: Although this study shows an association between the detection of resistance at failure and risk of clinical progression, further research is needed to clarify whether resistance reflects poor adherence or directly increases the risk of clinical events via exhaustion of drug options.

Detection of clusters using space-time scan statistics

This paper aims at detecting spatio-temporal clustering in fire sequences using space?time scan statistics, a powerful statistical framework for the analysis of point processes. The methodology is applied to active fire detection in the state of Florida (US) identified by MODIS (Moderate Resolution Imaging Spectroradiometer) during the period 2003?06. Results of the present study show that statistically significant clusters can be detected and localized in specific areas and periods of the year. Three out of the five most likely clusters detected for the entire frame period are localized in the north of the state, and they cover forest areas; the other two clusters cover a large zone in the south, corresponding to agricultural land and the prairies in the Everglades. In order to analyze if the wildfires recur each year during the same period, the analyses have been performed separately for the 4 years: it emerges that clusters of forest fires are more frequent in hot seasons (spring and summer), while in the southern areas, they are widely present during the whole year. The recognition of overdensities of events and the ability to locate them in space and in time can help in supporting fire management and focussing on prevention measures.