Detection and thinning of edges in previously known directions

This work presents a study on the generation of digital masks aiming at edge detection with previously known directions. This solution is important when edge direction is available either from a direction histogram or from a prediction based on camera and object models. A modification in the non-maximum suppression method of thinning is also presented enabling the comparison of local maxima for any edge directions. Results with a synthetic image and with crops of a CBERS satellite images are presented showing an example with its application in road detection, provided that directions are previously known.

Semiautomatic Detection of Scoliotic Rib Borders From Posteroanterior Chest Radiographs

3-D assessment of scoliotic deformities relies on an accurate 3-D reconstruction of bone structures from biplanar X-rays, which requires a precise detection and matching of anatomical structures in both views. In this paper, we propose a novel semiautomated technique for detecting complete scoliotic rib borders from PA-0° and PA-20° chest radiographs, by using an edge-following approach with multiple-path branching and oriented filtering. Edge-following processes are initiated from user starting points along upper and lower rib edges and the final rib border is obtained by finding the most parallel pair among detected edges. The method is based on a perceptual analysis leading to the assumption that no matter how bent a scoliotic rib is, it will always present relatively parallel upper and lower edges. The proposed method was tested on 44 chest radiographs of scoliotic patients and was validated by comparing pixels from all detected rib borders against their reference locations taken from the associated manually delineated rib borders. The overall 2-D detection accuracy was 2.64 ± 1.21 pixels. Comparing this accuracy level to reported results in the literature shows that the proposed method is very well suited for precisely detecting borders of scoliotic ribs from PA-0° and PA-20° chest radiographs.

Brain responses to auditory and visual stimulus offset: Shared representations of temporal edges

Edges are crucial for the formation of coherent objects from sequential sensory inputs within a single modality. Moreover, temporally coincident boundaries of perceptual objects across different sensory modalities facilitate crossmodal integration. Here, we used functional magnetic resonance imaging in order to examine the neural basis of temporal edge detection across modalities. Onsets of sensory inputs are not only related to the detection of an edge but also to the processing of novel sensory inputs. Thus, we used transitions from input to rest (offsets) as convenient stimuli for studying the neural underpinnings of visual and acoustic edge detection per se. We found, besides modality-specific patterns, shared visual and auditory offset-related activity in the superior temporal sulcus and insula of the right hemisphere. Our data suggest that right hemispheric regions known to be involved in multisensory processing are crucial for detection of edges in the temporal domain across both visual and auditory modalities. This operation is likely to facilitate cross-modal object feature binding based on temporal coincidence. Hum Brain Mapp, 2008. (c) 2008 Wiley-Liss, Inc.

A Cruciform Electron Donor-Acceptor Semiconductor with Solid-State Red Emission: 1D/2D Optical Waveguides and Highly Sensitive/Selective Detection of H2S Gas

In this paper, a new cruciform donor–acceptor molecule 2,2'-((5,5'-(3,7-dicyano-2,6-bis(dihexylamino)benzo[1,2-b:4,5-b']difuran-4,8-diyl)bis(thiophene-5,2-diyl))bis (methanylylidene))dimalononitrile (BDFTM) is reported. The compound exhibits both remarkable solid-state red emission and p-type semiconducting behavior. The dual functions of BDFTM are ascribed to its unique crystal structure, in which there are no intermolecular face-to-face π–π interactions, but the molecules are associated by intermolecular CN…π and H-bonding interactions. Firstly, BDFTM exhibits aggregation-induced emission; that is, in solution, it is almost non-emissive but becomes significantly fluorescent after aggregation. The emission quantum yield and average lifetime are measured to be 0.16 and 2.02 ns, respectively. Crystalline microrods and microplates of BDFTM show typical optical waveguiding behaviors with a rather low optical loss coefficient. Moreover, microplates of BDFTM can function as planar optical microcavities which can confine the emitted photons by the reflection at the crystal edges. Thin films show an air-stable p-type semiconducting property with a hole mobility up to 0.0015 cm2V−1s−1. Notably, an OFET with a thin film of BDFTM is successfully utilized for highly sensitive and selective detection of H2S gas (down to ppb levels).

Mach Bands: multi-scale spatial filtering and co-operative coding of edges and bars

Perception of Mach bands may be explained by spatial filtering ('lateral inhibition') that can be approximated by 2nd derivative computation, and several alternative models have been proposed. To distinguish between them, we used a novel set of ‘generalised Gaussian’ images, in which the sharp ramp-plateau junction of the Mach ramp was replaced by smoother transitions. The images ranged from a slightly blurred Mach ramp to a Gaussian edge and beyond, and also included a sine-wave edge. The probability of seeing Mach Bands increased with the (relative) sharpness of the junction, but was largely independent of absolute spatial scale. These data did not fit the predictions of MIRAGE, nor 2nd derivative computation at a single fine scale. In experiment 2, observers used a cursor to mark features on the same set of images. Data on perceived position of Mach bands did not support the local energy model. Perceived width of Mach bands was poorly explained by a single-scale edge detection model, despite its previous success with Mach edges (Wallis & Georgeson, 2009, Vision Research, 49, 1886-1893). A more successful model used separate (odd and even) scale-space filtering for edges and bars, local peak detection to find candidate features, and the MAX operator to compare odd- and even-filter response maps (Georgeson, VSS 2006, Journal of Vision 6(6), 191a). Mach bands are seen when there is a local peak in the even-filter (bar) response map, AND that peak value exceeds corresponding responses in the odd-filter (edge) maps.

Early visual detection of oriented line targets: spatial characteristics,and reference frames of early visual orientation-processing

The orientations of lines and edges are important in defining the structure of the visual environment, and observers can detect differences in line orientation within the first few hundred milliseconds of scene viewing. The present work is a psychophysical investigation of the mechanisms of early visual orientation-processing. In experiments with briefly presented displays of line elements, observers indicated whether all the elements were uniformly oriented or whether a uniquely oriented target was present among uniformly oriented nontargets. The minimum difference between nontarget and target orientations that was required for effective target-detection (the orientation increment threshold) varied little with the number of elements and their spatial density, but the percentage of correct responses in detection of a large orientation-difference increased with increasing element density. The differing variations with element density of thresholds and percent-correct scores may indicate the operation of more than one mechanism in early visual orientation-processIng. Reducing element length caused threshold to increase with increasing number of elements, showing that the effectiveness of rapid, spatially parallel orientation-processing depends on element length. Orientational anisotropy in line-target detection has been reported previously: a coarse periodic variation and some finer variations in orientation increment threshold with nontarget orientation have been found. In the present work, the prominence of the coarse variation in relation to finer variations decreased with increasing effective viewing duration, as if the operation of coarse orientation-processing mechanisms precedes the operation of finer ones. Orientational anisotropy was prominent even when observers lay horizontally and viewed displays by looking upwards through a black cylinder that excluded all possible visual references for orientation. So, gravitational and visual cues are not essential to the definition of an orientational reference frame for early vision, and such a reference can be well defined by retinocentric neural coding, awareness of body-axis orientation, or both.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Detection of anti-Toxoplasma gondii antibodies in experimentally and naturally infected non-human primates by Indirect Fluorescence Assay (IFA) and indirect ELISA

The Indirect Fluorescence Assay (IFA) and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI) with the IFA (IgG and IgM) and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI). Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2%) seropositive animals for this parasite and 149 (70.8%) negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.