Improving the scientific reliability of biological detection of explosives by Canis familiaris: Active odour signatures and their implications

The use of canines as a method of detection of explosives is well established worldwide and those applying this technology range from police forces and law enforcement to humanitarian agencies in the developing world. Despite the recent surge in publication of novel instrumental sensors for explosives detection, canines are still regarded by many to be the most effective real-time field method of explosives detection. However, unlike instrumental methods, currently it is difficult to determine detection levels, perform calibration of the canines' ability or produce scientifically valid quality control checks. Accordingly, amongst increasingly strict requirements regarding forensic evidence admission such as Frye and Daubert, there is a need for better scientific understanding of the process of canine detection. ^ When translated to the field of canine detection, just like any instrumental technique, peer reviewed publication of the reliability, success and error rates, is required for admissibility. Commonly training is focussed towards high explosives such as TNT and Composition 4, and the low explosives such as Black and Smokeless Powders are added often only for completeness. ^ Headspace analyses of explosive samples, performed by Solid Phase Microextraction (SPME) paired with Gas Chromatography - Mass Spectrometry (GC-MS), and Gas Chromatography - Electron Capture Detection (GC-ECD) was conducted, highlighting common odour chemicals. The odour chemicals detected were then presented to previously trained and certified explosives detection canines, and the activity/inactivity of the odour determined through field trials and experiments. ^ It was demonstrated that TNT and cast explosives share a common odour signature, and the same may be said for plasticized explosives such as Composition C-4 and Deta Sheet. Conversely, smokeless powders were demonstrated not to share common odours. An evaluation of the effectiveness of commercially available pseudo aids reported limited success. The implications of the explosive odour studies upon canine training then led to the development of novel inert training aids based upon the active odours determined. ^

The development of an optimized system of narcotic and explosive contraband mimics for calibration and training of biological detectors

Current commercially available mimics contain varying amounts of either the actual explosive/drug or the chemical compound of suspected interest by biological detectors. As a result, there is significant interest in determining the dominant chemical odor signatures of the mimics, often referred to as pseudos, particularly when compared to the genuine contraband material. This dissertation discusses results obtained from the analysis of drug and explosive headspace related to the odor profiles as recognized by trained detection canines. Analysis was performed through the use of headspace solid phase microextraction in conjunction with gas chromatography mass spectrometry (HS-SPME-GC-MS). Upon determination of specific odors, field trials were held using a combination of the target odors with COMPS. Piperonal was shown to be a dominant odor compound in the headspace of some ecstasy samples and a recognizable odor mimic by trained detection canines. It was also shown that detection canines could be imprinted on piperonal COMPS and correctly identify ecstasy samples at a threshold level of approximately 100ng/s. Isosafrole and/or MDP-2-POH show potential as training aid mimics for non-piperonal based MDMA. Acetic acid was shown to be dominant in the headspace of heroin samples and verified as a dominant odor in commercial vinegar samples; however, no common, secondary compound was detected in the headspace of either. Because of the similarities detected within respective explosive classes, several compounds were chosen for explosive mimics. A single based smokeless powder with a detectable level of 2,4-dinitrotoluene, a double based smokeless powder with a detectable level of nitroglycerine, 2-ethyl-1-hexanol, DMNB, ethyl centralite and diphenylamine were shown to be accurate mimics for TNT-based explosives, NG-based explosives, plastic explosives, tagged explosives, and smokeless powders, respectively. The combination of these six odors represents a comprehensive explosive odor kit with positive results for imprint on detection canines. As a proof of concept, the chemical compound PFTBA showed promise as a possible universal, non-target odor compound for comparison and calibration of detection canines and instrumentation. In a comparison study of shape versus vibration odor theory, the detection of d-methyl benzoate and methyl benzoate was explored using canine detectors. While results did not overwhelmingly substantiate either theory, shape odor theory provides a better explanation of the canine and human subject responses.

Development of a dynamic headspace concentration technique for the non-contact sampling of human odor samples and the creation of canine training aids

Human scent and human remains detection canines are used to locate living or deceased humans under many circumstances. Human scent canines locate individual humans on the basis of their unique scent profile, while human remains detection canines locate the general scent of decomposing human remains. Scent evidence is often collected by law enforcement agencies using a Scent Transfer Unit, a dynamic headspace concentration device. The goals of this research were to evaluate the STU-100 for the collection of human scent samples, and to apply this method to the collection of living and deceased human samples, and to the creation of canine training aids. The airflow rate and collection material used with the STU-100 were evaluated using a novel scent delivery method. Controlled Odor Mimic Permeation Systems were created containing representative standard compounds delivered at known rates, improving the reproducibility of optimization experiments. Flow rates and collection materials were compared. Higher air flow rates usually yielded significantly less total volatile compounds due to compound breakthrough through the collection material. Collection from polymer and cellulose-based materials demonstrated that the molecular backbone of the material is a factor in the trapping and releasing of compounds. The weave of the material also affects compound collection, as those materials with a tighter weave demonstrated enhanced collection efficiencies. Using the optimized method, volatiles were efficiently collected from living and deceased humans. Replicates of the living human samples showed good reproducibility; however, the odor profiles from individuals were not always distinguishable from one another. Analysis of the human remains samples revealed similarity in the type and ratio of compounds. Two types of prototype training aids were developed utilizing combinations of pure compounds as well as volatiles from actual human samples concentrated onto sorbents, which were subsequently used in field tests. The pseudo scent aids had moderate success in field tests, and the Odor pad aids had significant success. This research demonstrates that the STU-100 is a valuable tool for dog handlers and as a field instrument; however, modifications are warranted in order to improve its performance as a method for instrumental detection.

The development of calibrants through characterization of volatile organic compounds from peroxide based explosives and a non-target chemical calibration compound

Detection canines represent the fastest and most versatile means of illicit material detection. This research endeavor in its most simplistic form is the improvement of detection canines through training, training aids, and calibration. This study focuses on developing a universal calibration compound for which all detection canines, regardless of detection substance, can be tested daily to ensure that they are working with acceptable parameters. Surrogate continuation aids (SCAs) were developed for peroxide based explosives along with the validation of the SCAs already developed within the International Forensic Research Institute (IFRI) prototype surrogate explosives kit. Storage parameters of the SCAs were evaluated to give recommendations to the detection canine community on the best possible training aid storage solution that minimizes the likelihood of contamination. Two commonly used and accepted detection canine imprinting methods were also evaluated for the speed in which the canine is trained and their reliability. As a result of the completion of this study, SCAs have been developed for explosive detection canine use covering: peroxide based explosives, TNT based explosives, nitroglycerin based explosives, tagged explosives, plasticized explosives, and smokeless powders. Through the use of these surrogate continuation aids a more uniform and reliable system of training can be implemented in the field than is currently used today. By examining the storage parameters of the SCAs, an ideal storage system has been developed using three levels of containment for the reduction of possible contamination. The developed calibration compound will ease the growing concerns over the legality and reliability of detection canine use by detailing the daily working parameters of the canine, allowing for Daubert rules of evidence admissibility to be applied. Through canine field testing, it has been shown that the IFRI SCAs outperform other commercially available training aids on the market. Additionally, of the imprinting methods tested, no difference was found in the speed in which the canines are trained or their reliability to detect illicit materials. Therefore, if the recommendations discovered in this study are followed, the detection canine community will greatly benefit through the use of scientifically validated training techniques and training aids.

The Creation and Evaluation of Novel Canine Training Aids for Cocaine Using Molecularly Encapsulated Sol-Gel Polymers and an Investigation of Canine Field Accuracy

Biological detectors, such as canines, are valuable tools used for the rapid identification of illicit materials. However, recent increased scrutiny over the reliability, field accuracy, and the capabilities of each detection canine is currently being evaluated in the legal system. For example, the Supreme Court case, State of Florida v. Harris, discussed the need for continuous monitoring of canine abilities, thresholds, and search capabilities. As a result, the fallibility of canines for detection was brought to light, as well as a need for further research and understanding of canine detection. This study is two-fold, as it looks to not only create new training aids for canines that can be manipulated for dissipation control, but also investigates canine field accuracy to objects with similar odors to illicit materials. It was the goal of this research to improve upon current canine training aid mimics. Sol-gel polymer training aids, imprinted with the active odor of cocaine, were developed. This novel training aid improved upon the longevity of currently existing training aids, while also provided a way to manipulate the polymer network to alter the dissipation rate of the imprinted active odors. The manipulation of the polymer network could allow handlers to control the abundance of odors presented to their canines, familiarizing themselves to their canine’s capabilities and thresholds, thereby increasing the canines’ strength in court. The field accuracy of detection canines was recently called into question during the Supreme Court case, State of Florida v. Jardines, where it was argued that if cocaine’s active odor, methyl benzoate, was found to be produced by the popular landscaping flower, snapdragons, canines will false alert to said flowers. Therefore, snapdragon flowers were grown and tested both in the laboratory and in the field to determine the odors produced by snapdragon flowers; the persistence of these odors once flowers have been cut; and whether detection canines will alert to both growing and cut flowers during a blind search scenario. Results revealed that although methyl benzoate is produced by snapdragon flowers, certified narcotics detection canines can distinguish cocaine’s odor profile from that of snapdragon flowers and will not alert.

The Development of an Optimized System of Narcotic and Explosive Contraband Mimics for Calibration and Training of Biological Detectors

Current commercially available mimics contain varying amounts of either the actual explosive/drug or the chemical compound of suspected interest by biological detectors. As a result, there is significant interest in determining the dominant chemical odor signatures of the mimics, often referred to as pseudos, particularly when compared to the genuine contraband material. This dissertation discusses results obtained from the analysis of drug and explosive headspace related to the odor profiles as recognized by trained detection canines. Analysis was performed through the use of headspace solid phase microextraction in conjunction with gas chromatography mass spectrometry (HS-SPME-GC-MS). Upon determination of specific odors, field trials were held using a combination of the target odors with COMPS. Piperonal was shown to be a dominant odor compound in the headspace of some ecstasy samples and a recognizable odor mimic by trained detection canines. It was also shown that detection canines could be imprinted on piperonal COMPS and correctly identify ecstasy samples at a threshold level of approximately 100ng/s. Isosafrole and/or MDP-2-POH show potential as training aid mimics for non-piperonal based MDMA. Acetic acid was shown to be dominant in the headspace of heroin samples and verified as a dominant odor in commercial vinegar samples; however, no common, secondary compound was detected in the headspace of either. Because of the similarities detected within respective explosive classes, several compounds were chosen for explosive mimics. A single based smokeless powder with a detectable level of 2,4-dinitrotoluene, a double based smokeless powder with a detectable level of nitroglycerine, 2-ethyl-1-hexanol, DMNB, ethyl centralite and diphenylamine were shown to be accurate mimics for TNT-based explosives, NG-based explosives, plastic explosives, tagged explosives, and smokeless powders, respectively. The combination of these six odors represents a comprehensive explosive odor kit with positive results for imprint on detection canines. As a proof of concept, the chemical compound PFTBA showed promise as a possible universal, non-target odor compound for comparison and calibration of detection canines and instrumentation. In a comparison study of shape versus vibration odor theory, the detection of d-methyl benzoate and methyl benzoate was explored using canine detectors. While results did not overwhelmingly substantiate either theory, shape odor theory provides a better explanation of the canine and human subject responses.

The Development of Calibrants through Characterization of Volatile Organic Compounds from Peroxide Based Explosives and a Non-target Chemical Calibration Compound

Detection canines represent the fastest and most versatile means of illicit material detection. This research endeavor in its most simplistic form is the improvement of detection canines through training, training aids, and calibration. This study focuses on developing a universal calibration compound for which all detection canines, regardless of detection substance, can be tested daily to ensure that they are working with acceptable parameters. Surrogate continuation aids (SCAs) were developed for peroxide based explosives along with the validation of the SCAs already developed within the International Forensic Research Institute (IFRI) prototype surrogate explosives kit. Storage parameters of the SCAs were evaluated to give recommendations to the detection canine community on the best possible training aid storage solution that minimizes the likelihood of contamination. Two commonly used and accepted detection canine imprinting methods were also evaluated for the speed in which the canine is trained and their reliability. As a result of the completion of this study, SCAs have been developed for explosive detection canine use covering: peroxide based explosives, TNT based explosives, nitroglycerin based explosives, tagged explosives, plasticized explosives, and smokeless powders. Through the use of these surrogate continuation aids a more uniform and reliable system of training can be implemented in the field than is currently used today. By examining the storage parameters of the SCAs, an ideal storage system has been developed using three levels of containment for the reduction of possible contamination. The developed calibration compound will ease the growing concerns over the legality and reliability of detection canine use by detailing the daily working parameters of the canine, allowing for Daubert rules of evidence admissibility to be applied. Through canine field testing, it has been shown that the IFRI SCAs outperform other commercially available training aids on the market. Additionally, of the imprinting methods tested, no difference was found in the speed in which the canines are trained or their reliability to detect illicit materials. Therefore, if the recommendations discovered in this study are followed, the detection canine community will greatly benefit through the use of scientifically validated training techniques and training aids.

The creation and evaluation of novel canine training aids for cocaine using molecularly encapsulated sol-gel polymers and an investigation of canine field accuracy

Biological detectors, such as canines, are valuable tools used for the rapid identification of illicit materials. However, recent increased scrutiny over the reliability, field accuracy, and the capabilities of each detection canine is currently being evaluated in the legal system. For example, the Supreme Court case, State of Florida v. Harris, discussed the need for continuous monitoring of canine abilities, thresholds, and search capabilities. As a result, the fallibility of canines for detection was brought to light, as well as a need for further research and understanding of canine detection. This study is two-fold, as it looks to not only create new training aids for canines that can be manipulated for dissipation control, but also investigates canine field accuracy to objects with similar odors to illicit materials. ^ It was the goal of this research to improve upon current canine training aid mimics. Sol-gel polymer training aids, imprinted with the active odor of cocaine, were developed. This novel training aid improved upon the longevity of currently existing training aids, while also provided a way to manipulate the polymer network to alter the dissipation rate of the imprinted active odors. The manipulation of the polymer network could allow handlers to control the abundance of odors presented to their canines, familiarizing themselves to their canine’s capabilities and thresholds, thereby increasing the canines’ strength in court.^ The field accuracy of detection canines was recently called into question during the Supreme Court case, State of Florida v. Jardines, where it was argued that if cocaine’s active odor, methyl benzoate, was found to be produced by the popular landscaping flower, snapdragons, canines will false alert to said flowers. Therefore, snapdragon flowers were grown and tested both in the laboratory and in the field to determine the odors produced by snapdragon flowers; the persistence of these odors once flowers have been cut; and whether detection canines will alert to both growing and cut flowers during a blind search scenario. Results revealed that although methyl benzoate is produced by snapdragon flowers, certified narcotics detection canines can distinguish cocaine’s odor profile from that of snapdragon flowers and will not alert.^

Detection of the ADP-ribosyltransferase toxin gene (cdtA) and its activity in Clostridium difficile isolates from Equidae

Clostridium difficile is an antibiotic-associated emerging pathogen of humans and animals. Thus far three toxins of C. difficile have been described: an enterotoxin (ToxA), a cytotoxin (ToxB) and an ADP-ribosyltransferase (CDT). In the present work we describe the first isolation of CDT producing C. difficile from Equidae with gastro-intestinal disease. Out of 17 C. difficile strains isolated from Equidae, 11 were positive for the genes tcdA and tcdB encoding ToxA and ToxB. In addition four of these 11 isolates were positive for the cdtA gene encoding the catalytic subunit of the ADP-ribosyltransferase CDT. Interestingly none of the isolates derived from canines (41 isolates) and felines (4 isolates) harboured the cdtA gene. In C. difficile field isolates which contained the cdtA gene, ADP-ribosyltransferase activity could also be detected in culture supernatants indicating expression and secretion of CDT. All strains were associated with intestinal disorders, but no association was found for the occurrence of toxins with a specific clinical diagnosis.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.