Detecção de sectores cruzados e optimização de cobertura em redes LTE

Trabalho Final de Mestrado para obtenção do grau de Mestre em Engenharia de Electrónica e Telecomunicações

Distortion-free enhancement of terahertz signals measured by electro-optic sampling. I. Theory

We present three methods for the distortion-free enhancement of THz signals measured by electro-optic sampling in zinc blende-type detector crystals, e.g., ZnTe or GaP. A technique commonly used in optically heterodyne-detected optical Kerr effect spectroscopy is introduced, which is based on two measurements at opposite optical biases near the zero transmission point in a crossed polarizer detection geometry. In contrast to other techniques for an undistorted THz signal enhancement, it also works in a balanced detection scheme and does not require an elaborate procedure for the reconstruction of the true signal as the two measured waveforms are simply subtracted to remove distortions. We study three different approaches for setting an optical bias using the Jones matrix formalism and discuss them also in the framework of optical heterodyne detection. We show that there is an optimal bias point in realistic situations where a small fraction of the probe light is scattered by optical components. The experimental demonstration will be given in the second part of this two-paper series [J. Opt. Soc. Am. B, doc. ID 204877 (2014, posted online)].

Detection of circulating polysaccharide antigen of Schistosoma mansoni in hamster sera by crossed immunoelectrophoresis

Crossed immunoelectrophoresis (IEC) was used for detection of free and complexed circulating polisaccharide anodic antigen (AgCA) of Schistosoma mansoni in sera of infected hamsters. An attempt was also done to detect AgCA in human sera from patients infected with S. mansoni. The conditions for isolation and detection of complexed AgCA were established. The sensitivity of IEC was increased by incorporation of 2% polyethylene glicol (PEG) to the agarose and by maintaining the system at 4°C during the electrophoretic run. Free AgCA was detected in 12 and the complexed in 30 of the 37 hamsters sera analysed. Correlation between AgCA (free and complexed) and the parasite load was observed. AgCA was not detected, under the experimental conditions used, in human sera from 7 patients in the acute and 23 in the chronic phase of infection.

Scanning laser polarimetry with enhanced corneal compensation for detection of axonal loss in band atrophy of the optic nerve

PURPOSE: To compare the abilities of scanning laser polarimetry (SLP) with enhanced corneal compensation (ECC) and variable corneal compensation (VCC) modes for detection of retinal nerve fiber layer (RNFL) loss in eyes with band atrophy (BA) of the optic nerve. DESIGN. Cross-sectional study. METHODS: Thirty-seven eyes from 37 patients with BA and temporal visual field defect from chiasmal compression and 40 eyes from 40 healthy subjects were studied. Subjects underwent standard automated perimetry and RNFL measurements using an SLP device equipped with VCC and ECC. Receiver operating characteristic (ROC) curves were calculated for each parameter. Pearson correlation coefficients were obtained to evaluate the relationship between RNFL thickness parameters and severity of visual field loss, as assessed by the temporal mean defect. RESULTS: All RNFL thickness parameters were significantly lower in eyes with BA compared with normal eyes with both compensation modes. However, no statistically significant differences were observed in the areas under the ROC curves for the different parameters between GDx VCC and ECC (Carl Zeiss Meditec, Inc, Dublin, California, USA). Structure-function relationships also were similar for both compensation modes. CONCLUSIONS: No significant differences were found between the diagnostic accuracy of GDx ECC and that of VCC for detection of BA of the optic nerve. The use of GDx ECC does not seem to provide a better evaluation of RNFL loss on the temporal and nasal sectors of the peripapillary retina in subjects with BA of the optic nerve.

Multifocal pattern electroretinography for the detection of neural loss in eyes with permanent temporal hemianopia or quadrantanopia from chiasmal compression

Aims To evaluate the ability of multifocal transient pattern electroretinography (mfPERG) to detect neural loss and assess the relationship between mfPERG and visual-field (VF) loss in eyes with chiasmal compression. Methods 23 eyes from 23 patients with temporal VF defects and band atrophy of the optic nerve and 21 controls underwent standard automated perimetry and mfPERG using a stimulus pattern of 19 rectangles, each consisting of 12 squares. The response was determined for the central rectangle, for the nasal and temporal hemifields (eight rectangles each) and for each quadrant (three rectangles) in both patients and controls. Comparisons were made using variance analysis. Correlations between VF and mfPERG measurements were verified by linear regression analysis. Results Mean +/- SD mfPERG amplitudes from the temporal hemifield (0.50 +/- 0.17 and 0.62 +/- 0.32) and temporal quadrants (superior 0.42 +/- 0.21 and 0.52 +/- 0.35, inferior 0.51 +/- 0.23 and 0.74 +/- 0.40) were significantly lower in eyes with band atrophy than in controls (0.78 +/- 0.24, 0.89 +/- 0.28, 0.73 +/- 60.26, 0.96 +/- 0.36, 0.79 +/- 0.26 and 0.91 +/- 0.31, respectively). No significant difference was observed in nasal hemifield measurements. Significant correlations (0.36-0.73) were found between VF relative sensitivity and mfPERG amplitude in different VF sectors. Conclusions mfPERG amplitude measurements clearly differentiate eyes with temporal VF defect from controls. The good correlation between mfPERG amplitudes and the severity of VF defect suggests that mfPERG may be used as an indicator of ganglion cell dysfunction.

Evaluation of hemifield sector analysis protocol in multifocal visual evoked potential (MFVEP) objective perimetry for the diagnosis and early detection of glaucomatous field defects

Visual field assessment is a core component of glaucoma diagnosis and monitoring, and the Standard Automated Perimetry (SAP) test is considered up until this moment, the gold standard of visual field assessment. Although SAP is a subjective assessment and has many pitfalls, it is being constantly used in the diagnosis of visual field loss in glaucoma. Multifocal visual evoked potential (mfVEP) is a newly introduced method used for visual field assessment objectively. Several analysis protocols have been tested to identify early visual field losses in glaucoma patients using the mfVEP technique, some were successful in detection of field defects, which were comparable to the standard SAP visual field assessment, and others were not very informative and needed more adjustment and research work. In this study, we implemented a novel analysis approach and evaluated its validity and whether it could be used effectively for early detection of visual field defects in glaucoma. OBJECTIVES: The purpose of this study is to examine the effectiveness of a new analysis method in the Multi-Focal Visual Evoked Potential (mfVEP) when it is used for the objective assessment of the visual field in glaucoma patients, compared to the gold standard technique. METHODS: 3 groups were tested in this study; normal controls (38 eyes), glaucoma patients (36 eyes) and glaucoma suspect patients (38 eyes). All subjects had a two standard Humphrey visual field HFA test 24-2 and a single mfVEP test undertaken in one session. Analysis of the mfVEP results was done using the new analysis protocol; the Hemifield Sector Analysis HSA protocol. Analysis of the HFA was done using the standard grading system. RESULTS: Analysis of mfVEP results showed that there was a statistically significant difference between the 3 groups in the mean signal to noise ratio SNR (ANOVA p<0.001 with a 95% CI). The difference between superior and inferior hemispheres in all subjects were all statistically significant in the glaucoma patient group 11/11 sectors (t-test p<0.001), partially significant 5/11 (t-test p<0.01) and no statistical difference between most sectors in normal group (only 1/11 was significant) (t-test p<0.9). sensitivity and specificity of the HAS protocol in detecting glaucoma was 97% and 86% respectively, while for glaucoma suspect were 89% and 79%. DISCUSSION: The results showed that the new analysis protocol was able to confirm already existing field defects detected by standard HFA, was able to differentiate between the 3 study groups with a clear distinction between normal and patients with suspected glaucoma; however the distinction between normal and glaucoma patients was especially clear and significant. CONCLUSION: The new HSA protocol used in the mfVEP testing can be used to detect glaucomatous visual field defects in both glaucoma and glaucoma suspect patient. Using this protocol can provide information about focal visual field differences across the horizontal midline, which can be utilized to differentiate between glaucoma and normal subjects. Sensitivity and specificity of the mfVEP test showed very promising results and correlated with other anatomical changes in glaucoma field loss.

The role of hemifield sector analysis in multifocal visual evoked potential objective perimetry in the early detection of glaucomatous visual field defects

Objective: The purpose of this study was to examine the effectiveness of a new analysis method of mfVEP objective perimetry in the early detection of glaucomatous visual field defects compared to the gold standard technique. Methods and patients: Three groups were tested in this study; normal controls (38 eyes), glaucoma patients (36 eyes), and glaucoma suspect patients (38 eyes). All subjects underwent two standard 24-2 visual field tests: one with the Humphrey Field Analyzer and a single mfVEP test in one session. Analysis of the mfVEP results was carried out using the new analysis protocol: the hemifield sector analysis protocol. Results: Analysis of the mfVEP showed that the signal to noise ratio (SNR) difference between superior and inferior hemifields was statistically significant between the three groups (analysis of variance, P<0.001 with a 95% confidence interval, 2.82, 2.89 for normal group; 2.25, 2.29 for glaucoma suspect group; 1.67, 1.73 for glaucoma group). The difference between superior and inferior hemifield sectors and hemi-rings was statistically significant in 11/11 pair of sectors and hemi-rings in the glaucoma patients group (t-test P<0.001), statistically significant in 5/11 pairs of sectors and hemi-rings in the glaucoma suspect group (t-test P<0.01), and only 1/11 pair was statistically significant (t-test P<0.9). The sensitivity and specificity of the hemifield sector analysis protocol in detecting glaucoma was 97% and 86% respectively and 89% and 79% in glaucoma suspects. These results showed that the new analysis protocol was able to confirm existing visual field defects detected by standard perimetry, was able to differentiate between the three study groups with a clear distinction between normal patients and those with suspected glaucoma, and was able to detect early visual field changes not detected by standard perimetry. In addition, the distinction between normal and glaucoma patients was especially clear and significant using this analysis. Conclusion: The new hemifield sector analysis protocol used in mfVEP testing can be used to detect glaucomatous visual field defects in both glaucoma and glaucoma suspect patients. Using this protocol, it can provide information about focal visual field differences across the horizontal midline, which can be utilized to differentiate between glaucoma and normal subjects. The sensitivity and specificity of the mfVEP test showed very promising results and correlated with other anatomical changes in glaucomatous visual field loss. The intersector analysis protocol can detect early field changes not detected by the standard Humphrey Field Analyzer test. © 2013 Mousa et al, publisher and licensee Dove Medical Press Ltd.

Evaluation of hemifield sector analysis protocol in multifocal visual evoked potential objective perimetry for the diagnosis and early detection of glaucomatous field defects

CONCLUSIONS: The new HSA protocol used in the mfVEP testing can be applied to detect glaucomatous visual field defects in both glaucoma and glaucoma suspect patients. Using this protocol can provide information about focal visual field differences across the horizontal midline, which can be utilized to differentiate between glaucoma and normal subjects. Sensitivity and specificity of the mfVEP test showed very promising results and correlated with other anatomical changes in glaucoma field loss. PURPOSE: Multifocal visual evoked potential (mfVEP) is a newly introduced method used for objective visual field assessment. Several analysis protocols have been tested to identify early visual field losses in glaucoma patients using the mfVEP technique, some were successful in detection of field defects, which were comparable to the standard automated perimetry (SAP) visual field assessment, and others were not very informative and needed more adjustment and research work. In this study we implemented a novel analysis approach and evaluated its validity and whether it could be used effectively for early detection of visual field defects in glaucoma. METHODS: Three groups were tested in this study; normal controls (38 eyes), glaucoma patients (36 eyes) and glaucoma suspect patients (38 eyes). All subjects had a two standard Humphrey field analyzer (HFA) test 24-2 and a single mfVEP test undertaken in one session. Analysis of the mfVEP results was done using the new analysis protocol; the hemifield sector analysis (HSA) protocol. Analysis of the HFA was done using the standard grading system. RESULTS: Analysis of mfVEP results showed that there was a statistically significant difference between the three groups in the mean signal to noise ratio (ANOVA test, p < 0.001 with a 95% confidence interval). The difference between superior and inferior hemispheres in all subjects were statistically significant in the glaucoma patient group in all 11 sectors (t-test, p < 0.001), partially significant in 5 / 11 (t-test, p < 0.01), and no statistical difference in most sectors of the normal group (1 / 11 sectors was significant, t-test, p < 0.9). Sensitivity and specificity of the HSA protocol in detecting glaucoma was 97% and 86%, respectively, and for glaucoma suspect patients the values were 89% and 79%, respectively.

Threat analysis of IoT networks using artificial neural network intrusion detection system

The Internet of things (IoT) is still in its infancy and has attracted much interest in many industrial sectors including medical fields, logistics tracking, smart cities and automobiles. However, as a paradigm, it is susceptible to a range of significant intrusion threats. This paper presents a threat analysis of the IoT and uses an Artificial Neural Network (ANN) to combat these threats. A multi-level perceptron, a type of supervised ANN, is trained using internet packet traces, then is assessed on its ability to thwart Distributed Denial of Service (DDoS/DoS) attacks. This paper focuses on the classification of normal and threat patterns on an IoT Network. The ANN procedure is validated against a simulated IoT network. The experimental results demonstrate 99.4% accuracy and can successfully detect various DDoS/DoS attacks.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.