853 resultados para Collisional events
Resumo:
In Eastern South America, a series of fault-bounded sedimentary basins that crop out from Southern Uruguay to Southeastern Brazil were formed after the main collisional deformation of the Brasiliano Orogeny and record the tectonic events that affected the region from the Middle Ediacaran onwards. We address the problem of discerning the basin-forming tectonics from the later deformational events through paleostress analysis of more than 600 fault-slip data, mainly from the Camaquã Basin (Southern Brazil), sorted by stratigraphic level and cross-cutting relationships of superposed striations, and integrated with available stratigraphic and geochronological data. Our results show that the Camaquã Basin was formed by at least two distinct extensional events, and that rapid paleostress changes took place in the region a few tens of million years after the major collision (c.a. 630 Ma), probably due to the interplay between local active extensional tectonics and the distal effects of the continued amalgamation of plates and terranes at the margins of the still-forming Gondwana Plate. Preliminary paleostress data from the Castro Basin and published data from the Itajaí Basin suggest that these events had a regional nature.
Resumo:
The Borborema Province in northeastern South America is a typical Brasiliano-Pan-African branching system of Neoproterozoic orogens that forms part of the Western Gondwana assembly. The province is positioned between the Sao Luis-West Africa craton to the north and the Sao Francisco (Congo-Kasai) craton to the south. For this province the main characteristics are (a) its subdivision into five major tectonic domains, bounded mostly by long shear zones, as follows: Medio Coreau, Ceara Central, Rio Grande do Norte, Transversal, and Southern; (b) the alternation of supracrustal belts with reworked basement inliers (Archean nuclei + Paleoproterozoic belts); and (c) the diversity of granitic plutonism, from Neoproterozoic to Early Cambrian ages, that affect supracrustal rocks as well as basement inliers. Recently, orogenic rock assemblages of early Tonian (1000-920 Ma) orogenic evolution have been recognized, which are restricted to the Transversal and Southern domains of the Province. Within the Transversal Zone, the Alto Pajeu terrane locally includes some remnants of oceanic crust along with island arc and continental arc rock assemblages, but the dominant supracrustal rocks are mature and immature pelitic metasedimentary and metavolcaniclastic rocks. Contiguous and parallel to the Alto Pajeu terrane, the Riacho Gravata subterrane consists mainly of low-grade metamorphic successions of metarhythmites, some of which are clearly turbiditic in origin, metaconglomerates, and sporadic marbles, along with interbedded metarhyolitic and metadacitic volcanic or metavolcaniclastic rocks. Both terrane and subterrane are cut by syn-contractional intrusive sheets of dominantly peraluminous high-K calc-alkaline, granititic to granodioritic metaplutonic rocks. The geochemical patterns of both supracrustal and intrusive rocks show similarities with associations of mature continental arc volcano-sedimentary sequences, but some subordinate intra-plate characteristics are also found. In both the Alto Pajeu and Riacho Gravata terranes, TIMS and SHRIMP U-Pb isotopic data from zircons from both metavolcanic and metaplutonic rocks yield ages between 1.0 and 0.92 Ga, which define the time span for an event of orogenic character, the Cariris Velhos event. Less extensive occurrences of rocks of Cariris Velhos age are recognized mainly in the southernmost domains of the Province, as for example in the Polo Redondo-Maranco terrane, where arc-affinity migmatite-granitic and meta-volcano-sedimentary rocks show U-Pb ages (SHRIMP data) around 0.98-0.97 Ga. For all these domains, Sm-Nd data exhibit Tom model ages between 1.9 and 1.1 Ga with corresponding slightly negative to slightly positive epsilon(Nd)(t) values. These domains, along with the Borborema Province as a whole, were significantly affected by tectonic and magmatic events of the Brasiliano Cycle (0.7-0.5 Ga), so that it is possible that there are some other early Tonian rock assemblages which were completely masked and hidden by these later Brasiliano events. Cariris Velhos processes are younger than the majority of orogenic systems at the end of Mesoproterozoic Era and beginning of Neoproterozoic throughout the world, e.g. Irumide belt, Kibaride belt and Namaqua-Natal belt, and considerably younger than those of the youngest orogenic process (Ottawan) in the Grenvillian System. Therefore, they were probably not associated with the proposed assembly of Rodinia. We suggest, instead, that Cariris Velhos magmatism and tectonism could have been related to a continental margin magmatic arc, with possible back-arc associations, and that this margin may have been a short-lived (<100 m.y.) leading edge of the newly assembled Rodinia supercontinent. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
The Sunsas-Aguapei province (1.20-0.95 Ga), SW Amazonian Craton, is a key area to study the heterogeneous effects of collisional events with Laurentia, which shows evidence of the Grenvillian and Sunsas orogens. The Sunsas orogen, characterized by an allochthonous collisional-type belt (1.11-1.00 Ga), is the youngest and southwestern most of the events recorded along the cratonic fringe. Its evolution occurred after a period of long quiescence and erosion of the already cratonized provinces (>1.30 Ga), that led to sedimentation of the Sunsas and Vibosi groups in a passive margin setting. The passive margin stage was roughly contemporary with intraplate tectonics that produced the Nova Brasilandia proto-oceanic basin (<1.21 Ga), the reactivation of the Ji-Parana shear zone network (1.18-1.12 Ga) and a system of aborted rifts that evolved to the Huanchaca-Aguapei basin (1.17-1.15 Ga). The Sunsas belt is comprised by the metamorphosed Sunsas and Vibosi sequences, the Rincon del Tigre mafic-ultramafic sill and granitic intrusive suites. The latter rocks yield epsilon(Nd(t)) signatures (-0.5 to -4.5) and geochemistry (S,1, A-types) suggesting their origin associated with a continental arc setting. The Sunsas belt evolution is marked by ""tectonic fronts"" with sinistral offsets that was active from c. 1.08 to 1.05 Ga, along the southern edge of the Paragua microcontinent where K/Ar ages (1.27-1.34 Ga) and the Huanchaca-Aguapei flat-lying cover attest to the earliest tectonic stability at the time of the orogen. The Sunsas dynamics is coeval with inboard crustal shortening, transpression and magmatism in the Nova Brasilandia belt (1.13-1.00 Ga). Conversely, the Aguapei aulacogen (0.96-0.91 Ga) and nearby shear zones (0.93-0.91 Ga) are the late tectonic offshoots over the cratonic margin. The post-tectonic to anorogenic stages took place after ca. 1.00 Ga, evidenced by the occurrences of intra-plate A-type granites, pegmatites, mafic dikes and sills, as well as of graben basins. Integrated interpretation of the available data related to the Sunsas orogen supports the idea that the main nucleus of Rodinia incorporated the terrains forming the SW corner of Amazonia and most of the Grenvillian margin, as a result of two independent collisional events, as indicated in the Amazon region by the Ji-Parana shear zone event and the Sunsas belt, respectively. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
In central Antarctica, drainage today and earlier back to the Paleozoic radiates from the Gamburtsev Subglacial Mountains (GSM). Proximal to the GSM past the Permian-Triassic fluvial sandstones in the Prince Charles Mountains (PCM) are Cretaceous, Eocene, and Pleistocene sediment in Prydz Bay (ODP741, 1166, and 1167) and pre-Holocene sediment in AM04 beneath the Amery Ice Shelf. We analysed detrital zircons for U-Pb ages, Hf-isotope compositions, and trace elements to determine the age, rock type, source of the host magma, and "crustal" model age (T(C)DM). These samples, together with others downslope from the GSM and the Vostok Subglacial Highlands (VSH), define major clusters of detrital zircons interpreted as coming from (1) 700 to 460 Ma mafic granitoids and alkaline rock, epsilon-Hf 9 to -28, signifying derivation 2.5 to 1.3 Ga from fertile and recycled crust, and (2) 1200-900 Ma mafic granitoids and alkaline rock, epsilon-Hf 11 to -28, signifying derivation 1.8 to 1.3 Ga from fertile and recycled crust. Minor clusters extend to 3350 Ma. Similar detrital zircons in Permian-Triassic, Ordovician, Cambrian, and Neoproterozoic sandstones located along the PaleoPacific margin of East Antarctica and southeast Australia further downslope from central Antarctica reflect the upslope GSM-VSH nucleus of the central Antarctic provenance as a complex of 1200-900 Ma (Grenville) mafic granitoids and alkaline rocks and older rocks embedded in 700-460 Ma (Pan-Gondwanaland) fold belts. The wider central Antarctic provenance (CAP) is tentatively divided into a central sector with negative ?Hf in its 1200-900 Ma rocks bounded on either side by positive epsilon-Hf. The high ground of the GSM-VSH in the Permian and later to the present day is attributed to crustal shortening by far-field stress during the 320 Ma mid-Carboniferous collision of Gondwanaland and Laurussia. Earlier uplifts in the ~500 Ma Cambrian possibly followed the 700-500 Ma assembly of Gondwanaland, and in the Neoproterozoic the 1000-900 Ma collisional events in the Eastern Ghats-Rayner Province at the end of the 1300-1000 Ma assembly of Rodinia.
Resumo:
Reconstruction of the geologic history of the Yenisey Ridge, which developed as an accretionary collision orogen on the western margin of the Siberian craton is essential to understanding the evolution of mobile belts surrounding older cratons, as well as to resolving the recently much debated problem of whether Siberia was part of the supercontinent Rodinia. Available paleotectonic models suggest that this supercontinent was assembled at the Middle-Late Riphean boundary (1100-900 Ma) as a result of the Grenville orogeny, the first long-lived mountain building event which occurred in geosynclinal areas during the Neogaea. However, the character of crustal evolution at that stage is still speculative due to the lack of reliable and conclusive isotope data. In many current geodynamic models, a common underlying assumption is that the Yenisey Ridge showed very little endogenic activity for 1 Gyr, from the time of Tarak granite emplacement (1900-1840 Ma) to the Middle Neoproterozoic (~750 Ma). On the basis of this assumption, several recent studies suggested the absence of Grenvillian collisional events within the Yenisey Ridge. The results of the SHRIMP II U-Pb analysis of rift-related plagiogranites of the Nemtikha Complex, Yenisey Ridge (1380-1360 Ma) suggest an increase in magmatic activity in the Mesoproterozoic. Interpretation of these results in terms of a supercontinent cycle may help find evidence for possible occurrence of the Grenville orogeny on the western margin of the Siberian craton. With this in mind, we attempted to reconstruct using recent geochronological constraints the evolution of metapelitic rocks from the Teya polymetamorphic complex (TPMC), which is a good example of superimposed zoning of low and medium-pressure facies series. High precision age determinations from rock complexes formed in different geodynamic settings under different thermodynamic conditions and geothermal gradients were used to distinguish several major metamorphic events and unravel their time relations with tectonic and magmatic activity in the region.
Resumo:
Tese (doutorado)—Universidade de Brasília, Instituto de Física, 2015.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use
Resumo:
Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.
Resumo:
Background: Community and clinical data have suggested there is an association between trauma exposure and suicidal behavior (i.e., suicide ideation, plans and attempts). However, few studies have assessed which traumas are uniquely predictive of: the first onset of suicidal behavior, the progression from suicide ideation to plans and attempts, or the persistence of each form of suicidal behavior over time. Moreover, few data are available on such associations in developing countries. The current study addresses each of these issues. Methodology/Principal Findings: Data on trauma exposure and subsequent first onset of suicidal behavior were collected via structured interviews conducted in the households of 102,245 (age 18+) respondents from 21 countries participating in the WHO World Mental Health Surveys. Bivariate and multivariate survival models tested the relationship between the type and number of traumatic events and subsequent suicidal behavior. A range of traumatic events are associated with suicidal behavior, with sexual and interpersonal violence consistently showing the strongest effects. There is a dose-response relationship between the number of traumatic events and suicide ideation/attempt; however, there is decay in the strength of the association with more events. Although a range of traumatic events are associated with the onset of suicide ideation, fewer events predict which people with suicide ideation progress to suicide plan and attempt, or the persistence of suicidal behavior over time. Associations generally are consistent across high-, middle-, and low-income countries. Conclusions/Significance: This study provides more detailed information than previously available on the relationship between traumatic events and suicidal behavior and indicates that this association is fairly consistent across developed and developing countries. These data reinforce the importance of psychological trauma as a major public health problem, and highlight the significance of screening for the presence and accumulation of traumatic exposures as a risk factor for suicide ideation and attempt.