1000 resultados para Asynchronous detection
Resumo:
In this work we present the results of our attempt to build a compact photothermal spectrometer capable of both manual and automated mode of operation.The salient features of the system include the ability to analyse thin film, powder and polymer samples. The tool has been in use to investigate thermal, optical and transport properties. Binary and ternary semiconducting thin films were analysed for their thermal diffusivities. The system could perform thickness measurements nondestructively. Ion implanted semiconductors are widely studied for the effect of radiation induced defects. We could perform nondestructive imaging of defects using our spectrometer.The results reported in his thesis on the above in addition to studies on In2S3 and transparent conducting oxide ZnO have been achieved with this spectrometer. Various polymer samples have been easily analysed for their thermal diffusivities. The technique provided ease of analysis not achieved with conventional techniques like TGA and DSC. Industrial application of the tool has also been proved by analyzing defects of welded joints and adhesion of paints. Indigenization of the expensive lock-in-amplifier and automation has been the significant achievement in the course of this dissertation. We are on our way to prove the noise rejection capabilities of our PC LIA.
Resumo:
Linear CDMA detectors have emerged as a promising solution to multiple access interference (MAI) suppression. Unfortunately, most existing linear detectors suffer from high sensitivity to synchronisation errors (also termed parameter estimation error), and synchronisation error resistant detectors have so far not been as widely investigated as they should have. This paper extends the minimum variance distortionless response (MVDR) detector, proposed previously by this author (Zheng 2000) for synchronous systems, to asynchronous systems. It has been shown that the MVDR structure is equally effective for asynchronous systems, especially for the weaker users.
Resumo:
This paper proposes a convenient signaling scheme-orthogonal on-off BPSK (O3BPSK)-for near-far (NF) resistant detection in asynchronous direct-sequence code-division multiple-access (DS/CDMA) systems (uplink). The temporally adjacent bits from different users in the received signals are decoupled by using the on-off signaling, and the original data rate is maintained with no increase in transmission rate by adopting an orthogonal structure. The detector at the receiver is a one-shot linear decorrelating detector, which depends upon neither hard decision nor specific channel coding. The application of O3 strategy to the differentially encoded BPSK (D-BPSK) sequences is also presented. Finally, some computer simulations are shown to confirm the theoretical analysis.
Resumo:
Greater attention has been focused on the use of CDMA for future cellular mobile communications. CA near-far resistant detector for asynchronous code-division multiple-access (CDMA) systems operating in additive white Gaussian noise (AWGN) channels is presented. The multiuser interference caused by K users transmitting simultaneously, each with a specific signature sequence, is completely removed at the receiver. The complexity of this detector grows only linearly with the number of users, as compared to the optimum multiuser detector which requires exponential complexity in the number of users. A modified algorithm based on time diversity is described. It performs detection on a bit-by-bit basis and overcomes the complexity of using a sequence detector. The performance of this detector is shown to be superior to that of the conventional receiver.
Resumo:
The existing dual-rate blind linear detectors, which operate at either the low-rate (LR) or the high-rate (HR) mode, are not strictly blind at the HR mode and lack theoretical analysis. This paper proposes the subspace-based LR and HR blind linear detectors, i.e., bad decorrelating detectors (BDD) and blind MMSE detectors (BMMSED), for synchronous DS/CDMA systems. To detect an LR data bit at the HR mode, an effective weighting strategy is proposed. The theoretical analyses on the performance of the proposed detectors are carried out. It has been proved that the bit-error-rate of the LR-BDD is superior to that of the HR-BDD and the near-far resistance of the LR blind linear detectors outperforms that of its HR counterparts. The extension to asynchronous systems is also described. Simulation results show that the adaptive dual-rate BMMSED outperform the corresponding non-blind dual-rate decorrelators proposed by Saquib, Yates and Mandayam (see Wireless Personal Communications, vol. 9, p.197-216, 1998).
Resumo:
This paper proposes a new signaling scheme: orthogonal on-off BPSK (O3BPSK), for near-far resistant detection in the asynchronous DS/CDMA systems (up-link). The temporally adjacent bits from different users in the received signals are decoupled by using the on-off signaling, and the original data rate is maintained with no increase in transmission rate by adopting an orthogonal structure. The detector at the receiver is a one-shot linear decorrelating detector, which depends upon neither hard-decision nor specific channel coding. Some computer simulations are shown to confirm the theoretical analysis.
Resumo:
Zeki and co-workers recently proposed that perception can best be described as locally distributed, asynchronous processes that each create a kind of microconsciousness, which condense into an experienced percept. The present article is aimed at extending this theory to metacognitive feelings. We present evidence that perceptual fluency-the subjective feeling of ease during perceptual processing-is based on speed of processing at different stages of the perceptual process. Specifically, detection of briefly presented stimuli was influenced by figure-ground contrast, but not by symmetry (Experiment 1) or the font (Experiment 2) of the stimuli. Conversely, discrimination of these stimuli was influenced by whether they were symmetric (Experiment 1) and by the font they were presented in (Experiment 2), but not by figure-ground contrast. Both tasks however were related with the subjective experience of fluency (Experiments 1 and 2). We conclude that subjective fluency is the conscious phenomenal correlate of different processing stages in visual perception.
Resumo:
A blind nonlinear interference cancellation receiver for code-division multiple-access- (CDMA-) based communication systems operating over Rayleigh flat-fading channels is proposed. The receiver which assumes knowledge of the signature waveforms of all the users is implemented in an asynchronous CDMA environment. Unlike the conventional MMSE receiver, the proposed blind ICA multiuser detector is shown to be robust without training sequences and with only knowledge of the signature waveforms. It has achieved nearly the same performance of the conventional training-based MMSE receiver. Several comparisons and experiments are performed based on examining BER performance in AWGN and Rayleigh fading in order to verify the validity of the proposed blind ICA multiuser detector.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.