995 resultados para Arbitrary primers
Resumo:
Randomly amplified polymorphic DNA (RAPD) analysis of 35 Paracoccidioides brasiliensis isolates was carried out to evaluate the correlation of RAPD profiles with the virulence degree or the type of the clinical manifestations of human paracoccidioidomycosis. The dendrogram presented two main groups sharing 64% genetic similarity. Group A included two isolates from patients with chronic paracoccidioidomycosis; group B comprised the following isolates showing 65% similarity: two non-virulent, six attenuated, five virulent, eight from patients with chronic paracoccidioidomycosis and two from patients with acute paracoccidioidomycosis. The virulent Pb18 isolate and six attenuated or non-virulent samples derived from it were genetically indistinguishable (100% of similarity). Thus, in our study, RAPD patterns could not discriminate among 35 P. brasiliensis isolates according to their differences either in the degree of virulence or in the type of the clinical manifestation of this fungal infection. © 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Resumo:
Target region amplification polymorphism (TRAP) markers were used to estimate the genetic similarity (GS) among 53 sugarcane varieties and five species of the Saccharum complex. Seven fixed primers designed from candidate genes involved in sucrose metabolism and three from those involved in drought response metabolism were used in combination with three arbitrary primers. The clustering of the genotypes for sucrose metabolism and drought response were similar, but the GS based on Jaccard`s coefficient changed. The GS based on polymorphism in sucrose genes estimated in a set of 46 Brazilian varieties, all of which belong to the three Brazilian breeding programs, ranged from 0.52 to 0.9, and that based on drought data ranged from 0.44 to 0.95. The results suggest that genetic variability in the evaluated genes was lower in the sucrose metabolism genes than in the drought response metabolism ones.
Resumo:
Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular Information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability In three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced similar to 50 scoreable polymorphic DNA markers, between individuals of three Independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from Individual DNA samples that had been combined to create the bulked samples.
Resumo:
In a preliminary survey of genetic variability among 12 Australian isolates of Puccinia coronata f. sp. avenae Fraser and Led (Pca) collected from 1966 to 1993, two relatively diverse (
Resumo:
Biomphalaria tenagophila, one of the intermediate hosts of the trematoda Schistosoma mansoni, is a simultaneous hermafrodite snail species. In order to analyse the genetic structure of these populations, we performed a double-stringency PCR technique to obtain genetic markers with microsatellites and arbitrary primers in a single reaction.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The identification of cDNA clones from genomic regions known to contain human genes is usually the rate-limiting factor in positional cloning strategies. We demonstrate here that human genes present on yeast artificial chromosomes (YACs) are transcribed in yeast host cells. We have used the arbitrarily primed RNA (RAP) fingerprinting method to identify human-specific, transcribed sequences from YACs located in the 13q12 chromosome region. By comparing the RAP fingerprints generated using defined, arbitrary primers from various fragmented YACs, megaYACs, and host yeast, we were able to identify and map 20 products transcribed from the human YAC inserts. This method, therefore, permits the simultaneous isolation and mapping of novel expressed sequences directly from whole YACs.
Resumo:
Although “polymorphic castes” in social insects are well known as one of the most important phenomena of polyphenism, few studies of caste-specific gene expressions have been performed in social insects. To identify genes specifically expressed in the soldier caste of the Japanese damp-wood termite Hodotermopsis japonica, we employed the differential-display method using oligo(dT) and arbitrary primers, compared mRNA from the heads of mature soldiers and pseudergates (worker caste), and identified a clone (PCR product) 329 bp in length termed SOL1. Northern blot analysis showed that the SOL1 mRNA is about 1.0 kb in length and is expressed specifically in mature soldiers, but not in pseudergates, even in the presoldier induction by juvenile hormone analogue, suggesting that the product is specific for terminally differentiated soldiers. By using the method of 5′- and 3′-rapid amplification of cDNA ends, we isolated the full length of SOL1 cDNA, which contained an ORF with a putative signal peptide at the N terminus. The sequence showed no significant homology with any other known protein sequences. In situ hybridization analysis showed that SOL1 is expressed specifically in the mandibular glands. These results strongly suggest that the SOL1 gene encodes a secretory protein specifically synthesized in the mandibular glands of the soldiers. Histological observations revealed that the gland actually develops during the differentiation into the soldier caste.
Resumo:
The life history of Candida albicans presents an enigma: this species is thought to be exclusively asexual, yet strains show extensive phenotypic variation. To address the population genetics of C. albicans, we developed a genetic typing method for codominant single-locus markers by screening randomly amplified DNA for single-strand conformation polymorphisms. DNA fragments amplified by arbitrary primers were initially screened for single-strand conformation polymorphisms and later sequenced using locus-specific primers. A total of 12 single base mutations and insertions were detected from six out of eight PCR fragments. Patterns of sequence-level polymorphism observed for individual strains detected considerable heterozygosity at the DNA sequence level, supporting the view that most C. albicans strains are diploid. Population genetic analyses of 52 natural isolates from Duke University Medical Center provide evidence for both clonality and recombination in C. albicans. Evidence for clonality is supported by the presence of several overrepresented genotypes, as well as by deviation of genotypic frequencies from random (Hardy-Weinberg) expectations. However, tests for nonrandom association of alleles across loci reveal less evidence for linkage disequilibrium than expected for strictly clonal populations. Although C. albicans populations are primarily clonal, evidence for recombination suggests that sexual reproduction or some other form of genetic exchange occurs in this species.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.
Resumo:
In this work we prove that the Achilles-Manaresi multiplicity sequence, like the classical Hilbert-Samuel multiplicity, is additive with respect to the exact sequence of modules. We also prove the associativity formula for his mulitplicity sequence. As a consequence, we give new proofs for two results already known. First, the Achilles-Manaresi multiplicity sequence is an invariant up to reduction, a result first proved by Ciuperca. Second, I subset of J is a reduction of (J,M) if and only if c(0)(I(p), M(p)) = c(0)(J(p), M(p)) for all p is an element of Spec(A), a result first proved by Flenner and Manaresi.
Resumo:
We study quasinormal modes and scattering properties via calculation of the S matrix for scalar and electromagnetic fields propagating in the background of spherically symmetric and axially symmetric traversable Lorentzian wormholes of a generic shape. Such wormholes are described by the general Morris-Thorne ansatz. The properties of quasinormal ringing and scattering are shown to be determined by the behavior of the wormhole's shape function b(r) and shift factor Phi(r) near the throat. In particular, wormholes with the shape function b(r), such that b(dr) approximate to 1, have very long-lived quasinormal modes in the spectrum. We have proved that the axially symmetric traversable Lorentzian wormholes, unlike black holes and other compact rotating objects, do not allow for superradiance. As a by-product we have shown that the 6th order WKB formula used for scattering problems of black or wormholes gives quite high accuracy and thus can be used for quite accurate calculations of the Hawking radiation processes around various black holes.
Resumo:
A computational method based on the impulse response and on the discrete representation computational concept is proposed for the determination of the echo responses from arbitrary-geometry targets. It is supposed that each point of the transducer aperture can be considered as a source radiating hemispherical waves to the reflector. The local interaction with each of the hemispherical waves at the reflector surface can be modeled as a plane wave impinging on a planar surface, using the respective reflection coefficient. The method is valid for all field regions and can be performed for any excitation waveform radiated from an arbitrary acoustic aperture. The effects of target geometry, position, and material on both the amplitude and the shape of the echo response are studied. The model is compared with experimental results obtained using broadband transducers together with plane and cylindrical concave rectangular reflectors (aluminum, brass, and acrylic), as well as a circular cavity placed on a plane surface, in a water medium. The method can predict the measured echoes accurately. This paper shows an improved approach of the method, considering the reflection coefficient for all incident hemispherical waves arriving at each point of the target surface.
Resumo:
Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.