Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Metal-Nucleotide Interactions: Crystal Structures of Alkali (Li+, Na+, K+) and Alkaline Earth (Ca2+, Mg2+) Metal Complexes of Adenosine 2'-Monophosphate

Crystal structures of lithium, sodium, potassium, calcium and magnesium salts of adenosine 2'-monophosphate (2'-AMP) have been obtained at atomic resolution by X-ray crystallographic methods. 2'-AMP.Li belongs to the monoclinic space group P21 with a = 7.472(3)Å, b = 26.853(6) Å, c = 9.184(1)Å, b = 113.36(1)Å and Z= 4. 2'-AMP.Na and 2'-AMP.K crystallize in the trigonal space groups P31 and P3121 with a = 8.762(1)Å, c = 34.630(5)Å, Z= 6 and a = 8.931(4), Åc = 34.852(9)Å and Z= 6 respectively while 2'-AMP.Ca and 2'-AMP.Mg belong to space groups P6522 and P21 with cell parameters a = 9.487(2), c = 74.622(13), Z = 12 and a = 4.973(1), b = 10.023(2), c = 16.506(2), beta = 91.1(0) and Z = 2 respectively. All the structures were solved by direct methods and refined by full matrix least-squares to final R factors of 0.033, 0.028, 0.075, 0.069 and 0.030 for 2'-AMP.Li, 2'-AMP.Na, 2'- AMP.K, 2'-AMP.Ca and 2'-AMP.Mg, respectively. The neutral adenine bases in all the structures are in syn conformation stabilized by the O5'-N3 intramolecular hydrogen bond as in free acid and ammonium complex reported earlier. In striking contrast, the adenine base is in the anti geometry (cCN = -156.4(2)°) in 2'-AMP.Mg. Ribose moieties adopt C2'-endo puckering in 2'-AMP.Li and 2'-AMP.Ca, C2'-endo-C3'-exo twist puckering in 2'-AMP.Na and 2'-AMP.K and a C3'-endo-C2'-exo twist puckering in 2'-AMP.Mg structure. The conformation about the exocyclic C4'-C5' bond is the commonly observed gauche-gauche (g+) in all the structures except the gauche- trans (g-) conformation observed in 2'-AMP.Mg structure. Lithium ions coordinate with water, ribose and phosphate oxygens at distances 1.88 to 1.99Å. Na+ ions and K+ ions interact with phosphate and ribose oxygens directly and with N7 indirectly through a water oxygen. A distinct feature of 2'-AMP.Na and 2'-AMP.K structures is the involvement of ribose O4' in metal coordination. The calcium ion situated on a two-fold axis coordinates directly with three oxygens OW1, OW2 and O2 and their symmetry mates at distances 2.18 to 2.42Å forming an octahedron. A classic example of an exception to the existence of the O5'-N3 intramolecular hydorgen bond is the 2'-AMP.Mg strucure. Magnesium ion forms an octahedral coordination with three water and three phosphate oxygens at distances ranging from 2.02 to 2.11Å. A noteworthy feature of its coordination is the indirect link with N3 through OW3 oxygen resulting in macrochelation between the base and the phosphate group. Greater affnity of metal clays towards 5' compared to 2' and 3' nucleotides (J. Lawless, E. Edelson, and L. Manring, Am. Chem. Soc. Northwest Region Meeting, Seattle. 1978) due to macrochelation infered from solution studies (S. S. Massoud, H. Sigel, Eur. J. Biochem. 179, 451-458 (1989)) and interligand hydrogen bonding induced by metals postulated from metal-nucleotide structures in solid state (V. Swaminathan and M. Sundaralingam, CRC. Crit. Rev. Biochem. 6, 245-336 (1979)) are borne out by our structures also. The stacking patterns of adenine bases of both 2'-AMP.Na and 2'-AMP.K structures resemble the 2'-AMP.NH4 structure reported in the previous article. 2'-AMP.Li, 2'-AMP.Ca and 2'-AMP.Mg structures display base-ribose O4' stacking. An overview of interaction of monovalent and divalent cations with 2' and 5'-nucleotides has been presented.

Triplet repeat polymorphism & fragile X syndrome in the Indian context

Mental retardation due to fragile X syndrome is one of the genetic disorders caused by tripler repeat expansion, CGG repeat involved in this disease is known to exhibit polymorphism even among normal individuals. Here we describe the development of suitable probes for detection of polymorphism in CGG repeat at FMR1 locus as well as the diagnosis of fragile X syndrome. Using these methods polymorphism at the FMR1 locus has been examined in 161 individuals. Ninety eight patients with unclassified mental retardation were examined, of whom 7 were found to have the expanded (CGG) allele at the FMR1 locus, The hybridization pattern for two patients has been presented as representative data.

Relative stability of DNA as a generic criterion for promoter prediction: whole genome annotation of microbial genomes with varying nucleotide base composition

The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.

Nucleotide sequence and expression inE. coli of the complete P4 type VP4 from a G2 serotype human rotavirus

The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.

Characterization of the restriction enzyme-like endonuclease encoded by the Entamoeba histolytica non-long terminal repeat retrotransposon EhLINE1

The genome of the human pathogen Entamoeba histolytica, a primitive protist, contains non-long terminal repeat retrotransposable elements called EhLINEs. These encode reverse transcriptase and endonuclease required for retrotransposition. The endonuclease shows sequence similarity with bacterial restriction endonucleases. Here we report the salient enzymatic features of one such endonuclease. The kinetics of an EhLINE1-encoded endonuclease catalyzed reaction, determined under steady-state and single-turnover conditions, revealed a significant burst phase followed by a slower steady-state phase, indicating that release of product could be the slower step in this reaction. For circular supercoiled DNA the K-m was 2.6 x 10-8 m and the k(cat) was 1.6 x 10-2 sec-1. For linear E. histolytica DNA substrate the K-m and k(cat) values were 1.3 x 10-8 m and 2.2 x 10-4 sec-1 respectively. Single-turnover reaction kinetics suggested a noncooperative mode of hydrolysis. The enzyme behaved as a monomer. While Mg2+ was required for activity, 60% activity was seen with Mn2+ and none with other divalent metal ions. Substitution of PDX12-14D (a metal-binding motif) with PAX(12-14)D caused local conformational change in the protein tertiary structure, which could contribute to reduced enzyme activity in the mutated protein. The protein underwent conformational change upon the addition of DNA, which is consistent with the known behavior of restriction endonucleases. The similarities with bacterial restriction endonucleases suggest that the EhLINE1-encoded endonuclease was possibly acquired from bacteria through horizontal gene transfer. The loss of strict sequence specificity for nicking may have been subsequently selected to facilitate spread of the retrotransposon to intergenic regions of the E. histolytica genome.

Association of the microRNA-Single Nucleotide Polymorphism rs2910164 in miR146a with sporadic breast cancer susceptibility: A case control study

Background Breast cancer (BC) is primarily considered a genetic disorder with a complex interplay of factors including age, gender, ethnicity, family history, personal history and lifestyle with associated hormonal and non-hormonal risk factors. The SNP rs2910164 in miR146a (a G to C polymorphism) was previously associated with increased risk of BC in cases with at least a single copy of the C allele in breast cancer, though results in other cancers and populations have shown significant variation. Methods In this study, we examined this SNP in an Australian sporadic breast cancer population of 160 cases and matched controls, with a replicate population of 403 breast cancer cases using High Resolution Melting. Results Our analysis indicated that the rs2910164 polymorphism is associated with breast cancer risk in both primary and replicate populations (p = 0.03 and 0.0013, respectively). In contrast to the results of familial breast cancer studies, however, we found that the presence of the G allele of rs2910164 is associated with increased cancer risk, with an OR of 1.77 (95% CI 1.40–2.23). Conclusions The microRNA miR146a has a potential role in the development of breast cancer and the effects of its SNPs require further inquiry to determine the nature of their influence on breast tissue and cancer.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Azospirillum lipoferum tRNAs: Fractionation and identification of tRNA species and the nucleotide sequence of tRNA(Asn) (QUU)

Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.

Isolation and visualization of active presynaptic filaments of recA protein and single-stranded DNA

In the presence of ATP, recA protein forms a presynaptic complex with single-stranded DNA that is an obligatory intermediate in homologous pairing. Presynaptic complexes of recA protein and circular single strands that are active in forming joint molecules can be isolated by gel filtration. These isolated active complexes are nucleoprotein filaments with the following characteristics: (i) a contour length that is at least 1.5 times that of the corresponding duplex DNA molecule, (ii) an ordered structure visualized by negative staining as a striated filament with a repeat distance of 9.0 nm and a width of 9.3 nm, (iii) approximately 8 molecules of recA protein and 20 nucleotide residues per striation. The widened spacing between bases in the nucleoprotein filament means that the initial matching of complementary sequences must involve intertwining of the filament and duplex DNA, unwinding of the latter, or some combination of both to equalize the spacing between nascent base pairs. These experiments support the concept that recA protein first forms a filament with single-stranded DNA, which in turn binds to duplex DNA to mediate both homologous pairing and subsequent strand exchange.

A multiple nucleotide length polymorphism (MNLP) mediates androgen regulation of IRX4 in prostate cancer

Androgens and the androgen receptor (AR) play a crucial role in the initiation and progression of prostate cancer (PCa), regulating the expression of many PCa risk-associated genes. Iroquois Homeobox 4 (IRX4) has been recently identified with PCa risk and overexpressed in PCa. We observed a down-regulation of IRX4 expression in the cells undergoing epithelial to mesenchymal transition, suggesting its potential role in PCa progression and aim to delineate the androgenmediated regulation of IRX4 in PCa.

The complete mitochondrial genome of the tarnished plant bug, Lygus lineolaris (Heteroptera: Miridae)

The complete mitochondrial genome of the tarnished plant bug, Lygus lineolaris, comprised 17,027 bp. The genome contained 13 protein coding regions, 22 tRNA genes and 2 ribosomal RNA genes. The gene arrangement corresponded to the common order found among insect mtDNAs which was considered to be the ancestral arrangement. The protein coding genes started with ATN and stopped with TAA or TAG. The nucleotide distribution was 76.0% A + T. The control region contained two repeat regions, one was 24 bp and the other was 161 bp. The Genbank accession for the complete L. lineolaris mt genome is EU401991.