946 resultados para host-pathogen interaction


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Las NADPH oxidasas de plantas, denominadas “respiratory burst oxidase homologues” (RBOHs), producen especies reactivas del oxígeno (ROS) que median un amplio rango de funciones. En la célula vegetal, el ajuste preciso de la producción de ROS aporta la especificidad de señal para generar una respuesta apropiada ante las amenazas ambientales. RbohD y RbohF, dos de los diez genes Rboh de Arabidopsis, son pleiotrópicos y median diversos procesos fisiológicos en respuesta a patógenos. El control espacio-temporal de la expresión de los genes RbohD y RbohF podría ser un aspecto crítico para determinar la multiplicidad de funciones de estas oxidasas. Por ello, generamos líneas transgénicas de Arabidopsis con fusiones de los promoters de RbohD y RbohF a los genes delatores de la B-glucuronidasa y la luciferasa. Estas líneas fueron empleadas para revelar el patrón de expresión diferencial de RbohD y RbohF durante la respuesta inmune de Arabidopsis a la bacteria patógena Pseudomonas syringae pv. tomato DC3000, el hongo necrótrofo Plectosphaerella cucumerina y en respuesta a señales relacionadas con la respuesta inmune. Nuestros experimentos revelan un patrón de expresión diferencial de los promotores de RbohD y RbohF durante el desarrollo de la planta y en la respuesta inmune de Arabidopsis. Además hemos puesto de manifiesto que existe una correlación entre el nivel de actividad de los promotores de RbohD y RbohF con la acumulación de ROS y el nivel de muerte celular en respuesta a patógenos. La expression de RbohD y RbohF también es modulada de manera diferencial en respuesta a patrones moleculares asociados a patógenos (PAMPs) y por ácido abscísico (ABA). Cabe destacar que, mediante una estrategia de intercambio de promotores, hemos revelado que la región promotora de RbohD, es necesaria para dirigir la producción de ROS en respuesta a P. cucumerina. Adicionalmente, la activación del promotor de RbohD en respuesta al aislado de P. cucumerina no adaptado a Arabidopsis 2127, nos llevó a realizar ensayos de susceptibilidad con el doble mutante rbohD rbohF que han revelado un papel desconocido de estas oxidasas en resistencia no-huesped. La interacción entre la señalización dependiente de las RBOHs y otros componentes de la respuesta inmune de plantas podría explicar también las distintas funciones que median estas oxidasas en relación con la respuesta inmune. Entre la gran cantidad de señales coordinadas con la actividad de las RBOHs, existen evidencias genéticas y farmacológicas que indican que las proteínas G heterotriméricas están implicadas en algunas de las rutas de señalización mediadas por ROS derivadas de los RBOHs en respuesta a señales ambientales. Por ello hemos estudiado la relación entre estas RBOH-NADPH oxidasas y AGB1, la subunidad β de las proteínas G heterotriméricas en la respuesta inmune de Arabidopsis. Análisis de epistasis indican que las proteínas G heterotriméricas están implicadas en distintas rutas de señalización en defensa mediadas por las RBOHs. Nuestros resultados ilustran la relación compleja entre la señalización mediada por las RBOHs y las proteínas G heterotriméricas, que varía en función de la interacción planta-patógeno analizada. Además, hemos explorado la posible asociación entre AGB1 con RBOHD y RBOHF en eventos tempranos de la respuesta immune. Cabe señalar que experimentos de coímmunoprecipitación apuntan a una posible asociación entre AGB1 y la kinasa citoplasmática reguladora de RBOHD, BIK1. Esto indica un posible mecanismo de control de la función de esta NADPH oxidase por AGB1. En conjunto, estos datos aportan nuevas perspectivas sobre cómo, a través del control transcripcional o mediante la interacción con las proteínas G heterotriméricas, las NADPH oxidases de plantas median la producción de ROS y la señalización por ROS en la respuesta inmune. Nuestro trabajo ejemplifica cómo la regulación diferencial de dos miembros de una familia multigénica, les permite realizar distintas funciones fisiológicas especializadas usando un mismo mecanismo enzimático. ABSTRACT The plant NADPH oxidases, termed respiratory burst oxidase homologues (RBOHs), produce reactive oxygen species (ROS) which mediate a wide range of functions. Fine tuning this ROS production provides the signaling specificity to the plant cell to produce the appropriate response to environmental threats. RbohD and RbohF, two of the ten Rboh genes present in Arabidopsis, are pleiotropic and mediate diverse physiological processes in response to pathogens. One aspect that may prove critical to determine the multiplicity of functions of RbohD and RbohF is the spatio-temporal control of their gene expression. Thus, we generated Arabidopsis transgenic lines with RbohD- and RbohF-promoter fusions to the β-glucuronidase and the luciferase reporter genes. These transgenics were employed to reveal RbohD and RbohF promoter activity during Arabidopsis immune response to the pathogenic bacterium Pseudomonas syringae pv tomato DC3000, the necrotrophic fungus Plectosphaerella cucumerina and in response to immunity-related cues. Our experiments revealed a differential expression pattern of RbohD and RbohF throughout plant development and during Arabidopsis immune response. Moreover, we observed a correlation between the level of RbohD and RbohF promoter activity, the accumulation of ROS and the amount of cell death in response to pathogens. RbohD and RbohF gene expression was also differentially modulated by pathogen associated molecular patterns and abscisic acid. Interestingly, a promoter-swap strategy revealed the requirement for the promoter region of RbohD to drive the production of ROS in response to P. cucumerina. Additionally, since the RbohD promoter was activated during Arabidopsis interaction with a non-adapted P. cucumerina isolate 2127, we performed susceptibility tests to this fungal isolate that uncovered a new role of these oxidases on non-host resistance. The interplay between RBOH-dependent signaling with other components of the plant immune response might also explain the different immunity-related functions mediated by these oxidases. Among the plethora of signals coordinated with RBOH activity, pharmacological and genetic evidence indicates that heterotrimeric G proteins are involved in some of the signaling pathways mediated by RBOH–derived ROS in response to environmental cues. Therefore, we analysed the interplay between these RBOH-NADPH oxidases and AGB1, the Arabidopsis β-subunit of heterotrimeric G proteins during Arabidopsis immune response. We carried out epistasis studies that allowed us to test the implication of AGB1 in different RBOH-mediated defense signaling pathways. Our results illustrate the complex relationship between RBOH and heterotrimeric G proteins signaling, that varies depending on the type of plant-pathogen interaction. Furthermore, we tested the potential association between AGB1 with RBOHD and RBOHF during early immunity. Interestingly, our co-immunoprecipitation experiments point towards an association of AGB1 and the RBOHD regulatory kinase BIK1, thus providing a putative mechanism in the control of the NADPH oxidase function by AGB1. Taken all together, these studies provide further insights into the role that transcriptional control or the interaction with heterotrimeric G-proteins have on RBOH-NADPH oxidase-dependent ROS production and signaling in immunity. Our work exemplifies how, through a differential regulation, two members of a multigenic family achieve specialized physiological functions using a common enzymatic mechanism.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Os mecanismos moleculares envolvidos na resistência de plantas contra patógenos são um tema bastante discutido no meio acadêmico, sendo o objetivo maior dos estudos a diminuição das perdas de produtividade provocadas por doenças em plantações do mundo todo. Muitos modelos de interação patógeno-hospedeiro foram propostos e desenvolvidos priorizando plantas e culturas de rápido desenvolvimento com ciclo de vida curto. Espécies de ciclo longo, porém, devem lidar durante anos - ao menos até a idade reprodutiva - contra o ataque de bactérias, fungos e vírus, sem contar, nesse meio tempo, com recombinações genéticas e mutações que tornariam possível o escape contra as moléstias causadas por microrganismos. Assim, como alternativa aos modelos usuais, o presente trabalho estudou um diferente par de antagonistas: Eucalyptus grandis e Puccinia psidii. Apesar da contribuição de programas de melhoramento genético, o patossistema E. grandis X P. psidii ainda é pouco descrito no nível molecular, havendo poucos estudos sobre os processos e as moléculas que agem de forma a conferir resistência às plantas. Assim, buscando o melhor entendimento da relação entre E. grandis X P. psidii, o presente trabalho estudou a mudança dos perfis de proteínas e metabólitos secundários ocorrida nos tecidos foliares de plantas resistentes e susceptíveis durante a infecção pelo patógeno, com o auxílio da técnica de cromatografia líquida acoplada à espectrometria de massas. Os resultados obtidos indicam que as plantas resistentes percebem a presença do patógeno logo nas primeiras horas pós-infecção, produzindo proteínas ligadas à imunidade (HSP90, ILITYHIA, LRR Kinase, NB-ARC disease resistance protein). Essa percepção desencadeia a produção de proteínas de parede celular e de resposta oxidativa, além de modificar o metabolismo primário e secundário. As plantas susceptíveis, por outro lado, têm o metabolismo subvertido, produzindo proteínas responsáveis pelo afrouxamento da parede celular, beneficiando a absorção de nutrientes, crescimento e propagação de P. psidii. No trabalho também são propostos metabólitos biomarcadores de resistência, moléculas biomarcadoras de resposta imune e sinais da infecção por patógeno em E. grandis.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Helicobacter pylori colonizes the human stomach, where it causes gastritis that may develop into peptic ulcer disease or cancer when left untreated. Neisseria gonorrhoeae colonizes the urogenital tract and causes the sexually transmitted disease gonorrhea. In contrast, Lactobacillus species are part of the human microbiota, which is the resident microbial community, and are considered to be beneficial for health. The first host cell types that bacteria encounter when they enter the body are epithelial cells, which form the border between the inside and the outside, and macrophages, which are immune cells that engulf unwanted material.       The focus of this thesis has been the interaction between the host and bacteria, aiming to increase our knowledge of the molecular mechanisms that underlie the host responses and their effects on bacterial pathogenicity. Understanding the interactions between bacteria and the host will hopefully enable the development of new strategies for the treatment of infectious disease. In paper I, we investigated the effect of N. gonorrhoeae on the growth factor amphiregulin in cervical epithelial cells and found that the processing and release of amphiregulin changes upon infection. In paper II, we examined the expression of the transcription factor early growth response-1 (EGR1) in epithelial cells during bacterial colonization. We demonstrated that EGR1 is rapidly upregulated by many different bacteria. This upregulation is independent of the pathogenicity, Gram-staining type and level of adherence of the bacteria, but generally requires viable bacteria and contact with the host cell. The induction of EGR1 is mediated primarily by signaling through EGFR, ERK1/2 and β1-integrins. In paper III, we described the interactions of the uncharacterized protein JHP0290, which is secreted by H. pylori, with host cells. JHP0290 is able to bind to several cell types and induces apoptosis and TNF release in macrophages. For both of these responses, signaling through Src family kinases and ERK is essential. Apoptosis is partially mediated by TNF release. Finally, in paper IV, we showed that certain Lactobacillus strains can reduce the colonization of H. pylori on gastric epithelial cells. Lactobacilli decrease the gene expression of SabA and thereby inhibit the binding mediated by this adhesin.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Septins (SEPTs) form a family of GTP-binding proteins implicated in cytoskeleton and membrane organization, cell division and host/pathogen interactions. The precise function of many family members remains elusive. We show that SEPT6 and SEPT7 complexes bound to F-actin regulate protein sorting during multivesicular body (MVB) biogenesis. These complexes bind AP-3, an adapter complex sorting cargos destined to remain in outer membranes of maturing endosomes, modulate AP-3 membrane interactions and the motility of AP-3-positive endosomes. These SEPT-AP interactions also influence the membrane interaction of ESCRT (endosomal-sorting complex required for transport)-I, which selects ubiquitinated cargos for degradation inside MVBs. Whereas our findings demonstrate that SEPT6 and SEPT7 function in the spatial, temporal organization of AP-3- and ESCRT-coated membrane domains, they uncover an unsuspected coordination of these sorting machineries during MVB biogenesis. This requires the E3 ubiquitin ligase LRSAM1, an AP-3 interactor regulating ESCRT-I sorting activity and whose mutations are linked with Charcot-Marie-Tooth neuropathies.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

BACKGROUND: Enterotoxigenic Escherichia coli (ETEC) is a globally prevalent cause of diarrhea. Though usually self-limited, it can be severe and debilitating. Little is known about the host transcriptional response to infection. We report the first gene expression analysis of the human host response to experimental challenge with ETEC. METHODS: We challenged 30 healthy adults with an unattenuated ETEC strain, and collected serial blood samples shortly after inoculation and daily for 8 days. We performed gene expression analysis on whole peripheral blood RNA samples from subjects in whom severe symptoms developed (n = 6) and a subset of those who remained asymptomatic (n = 6) despite shedding. RESULTS: Compared with baseline, symptomatic subjects demonstrated significantly different expression of 406 genes highlighting increased immune response and decreased protein synthesis. Compared with asymptomatic subjects, symptomatic subjects differentially expressed 254 genes primarily associated with immune response. This comparison also revealed 29 genes differentially expressed between groups at baseline, suggesting innate resilience to infection. Drug repositioning analysis identified several drug classes with potential utility in augmenting immune response or mitigating symptoms. CONCLUSIONS: There are statistically significant and biologically plausible differences in host gene expression induced by ETEC infection. Differential baseline expression of some genes may indicate resilience to infection.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Over the past 50 years, many millions of European honey bee (Apis mellifera) colonies have died as the ectoparasitic mite, Varroa destructor, has spread around the world. Subsequent studies have indicated that the mite’s association with a group of RNA viral pathogens (Deformed Wing Virus, DWV) correlates with colony death. Here, we propose a phenomenon known as superinfection exclusion that provides an explanation of how certain A. mellifera populations have survived, despite Varroa infestation and high DWV loads. Next-generation sequencing has shown that a non-lethal DWV variant ‘type B’ has become established in these colonies and that the lethal ‘type A’ DWV variant fails to persist in the bee population. We propose that this novel stable host-pathogen relationship prevents the accumulation of lethal variants, suggesting that this interaction could be exploited for the development of an effective treatment that minimises colony losses in the future.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Over the past 50 years, many millions of European honey bee (Apis mellifera) colonies have died as the ectoparasitic mite, Varroa destructor, has spread around the world. Subsequent studies have indicated that the mite’s association with a group of RNA viral pathogens (Deformed Wing Virus, DWV) correlates with colony death. Here, we propose a phenomenon known as superinfection exclusion that provides an explanation of how certain A. mellifera populations have survived, despite Varroa infestation and high DWV loads. Next-generation sequencing has shown that a non-lethal DWV variant ‘type B’ has become established in these colonies and that the lethal ‘type A’ DWV variant fails to persist in the bee population. We propose that this novel stable host-pathogen relationship prevents the accumulation of lethal variants, suggesting that this interaction could be exploited for the development of an effective treatment that minimises colony losses in the future.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Invasive stages of apicomplexan parasites require a host cell to survive, proliferate and advance to the next life cycle stage. Once invasion is achieved, apicomplexans interact closely with the host cell cytoskeleton, but in many cases the different species have evolved distinct mechanisms and pathways to modulate the structural organization of cytoskeletal filaments. The host cell cytoskeleton is a complex network, largely, but not exclusively, composed of microtubules, actin microfilaments and intermediate filaments, all of which are modulated by associated proteins, and it is involved in diverse functions including maintenance of cell morphology and mechanical support, migration, signal transduction, nutrient uptake, membrane and organelle trafficking and cell division. The ability of apicomplexans to modulate the cytoskeleton to their own advantage is clearly beneficial. We here review different aspects of the interactions of apicomplexans with the three main cytoskeletal filament types, provide information on the currently known parasite effector proteins and respective host cell targets involved, and how these interactions modulate the host cell physiology. Some of these findings could provide novel targets that could be exploited for the development of preventive and/or therapeutic strategies.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Microbial symbionts can modulate host interactions with biotic and abiotic factors. Such interactions may affect the evolutionary trajectories of both host and symbiont. Wolbachia protects Drosophila melanogaster against several viral infections and the strength of the protection varies between variants of this endosymbiont. Since Wolbachia is maternally transmitted, its fitness depends on the fitness of its host. Therefore, Wolbachia populations may be under selection when Drosophila is subjected to viral infection. Here we show that in D. melanogaster populations selected for increased survival upon infection with Drosophila C virus there is a strong selection coefficient for specific Wolbachia variants, leading to their fixation. Flies carrying these selected Wolbachia variants have higher survival and fertility upon viral infection when compared to flies with the other variants. These findings demonstrate how the interaction of a host with pathogens shapes the genetic composition of symbiont populations. Furthermore, host adaptation can result from the evolution of its symbionts, with host and symbiont functioning as a single evolutionary unit.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Dissertação (mestrado)—Universidade de Brasília, Instituto de Ciências Biológicas, Departamento de Biologia Celular, Pós-Graduação em Biologia Molecular, 2016.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

An impedance method was developed to determine how immune system cells (hemocyte) interact with intruder cells (parasites). When the hemocyte cells interact with the parasites, they cause a defensive reaction and the parasites start to aggregate in clusters. The level of aggregation is a measure of the host-parasite interaction, and provides information about the efficiency of the immune system response. The cell aggregation is monitored using a set of microelectrodes. The impedance spectrum is measured between each individual microelectrode and a large reference electrode. As the cells starts to aggregate and settle down towards the microelectrode array the impedance of the system is changed. It is shown that the system impedance is very sensitive to the level of cell aggregation and can be used to monitor in real time the interaction between hemocyte cells and parasites.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease of human and veterinary concern. The identification of novel proteins that mediate host-pathogen interactions is important for understanding the bacterial pathogenesis as well as to identify protective antigens that would help fight the disease. We describe in this work the cloning, expression, purification and characterization of three predicted leptospiral membrane proteins, LIC10258, LIC12880 (Lp30) and LIC12238. We have employed Escherichia coli BL21 (SI) strain as a host expression system. Recently, we have identified LIC12238 as a plasminogen (PLG)-binding receptor. We show now that Lp30 and rLIC10258 are also PLG-receptors of Leptospira, both exhibiting dose-dependent and saturating binding (K(D), 68.8 +/- 25.2 nM and 167.39 +/- 60.1 nM, for rLIC10258 and rLIC12880, respectively). In addition, LIC10258, which is a novel OmpA-like protein, binds laminin and plasma fibronectin ECM molecules and hence, it was named Lsa66 (Leptospiral surface adhesin of 66 kDa). Binding of Lsa66 to ECM components was determined to be specific, dose-dependent and saturable, with a KD of 55.4 +/- 15.9 nM to laminin and of 290.8 +/- 11.8 nM to plasma fibronectin. Binding of the recombinant proteins to PLG or ECM components was assessed by using antibodies against each of the recombinant proteins obtained in mice and confirmed by monoclonal anti-polyhistidine antibodies. Lsa66 caused partial inhibition on leptospiral adherence to immobilized ECM and PLG. Moreover, this adhesin and rLIC12238 are recognized by antibodies in serum samples of confirmed leptospirosis cases. Thus, Lsa66 is a novel OmpA-like protein with dual activity that may promote the attachment of Leptospira to host tissues and may contribute to the leptospiral invasion. To our knowledge, this is the first leptospiral protein with ECM and PLG binding properties reported to date.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Neospora caninum, the causative agent of neosporosis, is an obligate intracellular parasite considered to be a major cause of abortion in cattle throughout the world. Most studies concerning N. caninum have focused on life cycle, seroepidemiology, pathology and vaccination, while data on host-parasite interaction, such as host cell migration, mechanisms of evasion and dissemination of this parasite during the early phase of infection are still poorly understood. Here we show the ability of excreted/secreted antigens from N. caninum (NcESAs) to attract monocytic cells to the site of primary infection in both in vitro and in vivo assays. Molecules from the family of cyclophilins present on the NcESAs were shown to work as chemokine-like proteins and NcESA-induced chemoattraction involved G(i) protein signaling and participation of CC-chemokine receptor 5 (CCR5). Additionally, we demonstrate the ability of NcESAs to enhance the expression of CCR5 on monocytic cells and this increase occurred in parallel with the chemotactic activity of NcESAs by increasing cell migration. These results suggest that during the first days of infection, N. caninum produces molecules capable of inducing monocytic cell migration to the sites of infection, which will consequently enhance initial parasite invasion and proliferation. Altogether, these results help to clarify some key features involved in the process of cell migration and may reveal virulence factors and therapeutic targets to control neosporosis. (C) 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Citrus black spot (CBS) caused by Guignardia citricarpa represents an important threat to citriculture in Brazil. Limited information is available regarding potential biological control agents and new alternative compounds that may provide protection of orange fruits against the disease. In this study, the effects of commercial products based on Bacillus thuringiensis var. kurstaki (Bt) bacterium, Bt pure isolates and Harpin protein (Messenger (R)) on the postharvest control of CBS, were evaluated in `Valencia` sweet orange fruits harvested for three consecutive years in a citrus grove. The fruits were sprayed with the following products: DiPel (R) WP (Bt, subspecies, kurstaki strain HD-1,16,000 International Units mg(-1), 32 g active ingredient kg(-1)) (1, 20 and 50 mg ml(-1)), Dimy Pel (R) WP (Bt, subspecies, kurstaki, strain HD-1, 17,600 IU mg(-1), 26 g active ingredient l(-1)) (2, 20 and 50 mg ml(-1)), Messenger (R) (3% harpin protein) (1 and 2 mg ml(-1)) and fungicide Tecto (R) Flowable SC (thiabendazole, 485 gl(-1)) (0.8g active ingredient l(-1)), besides the Bt isolates, Bt- HD-567, Bt- DiPel and Bt- Dimy (9 x 10(8) CFU ml(-1)). Ten days after treatment, the number of newly developed CBS lesions and pycnidia produced were evaluated using fifty fruits per treatment. The Dimy Pel (R) and Messenger (R) reduced the number of new developed CBS lesions on fruits in up to 67% and 62%, respectively. All applied treatments drastically decreased the number of pycnidia produced in the CBS lesions on orange fruits with 85% to 96% reductions compared to the untreated control. Volatile compounds produced by the isolates Bt- HD-567, Bt- Dimy and Bt- DiPel, reduced the number of lesions on treated fruits by 70%, 65% and 71% compared to the control, respectively. In addition, the survival of Bt isolates on orange fruit surfaces were evaluated by recovering and quantifying the number of CFU every seven days for up to 28 days. The declines in survival rates on orange fruit surfaces were drastic for the three strains of Bt in the first week. The CFU numbers of all applied isolates declined by 4 to 5 orders of magnitude after storage at room temperature for 28 days. In vitro assays revealed that the Bt isolates significantly reduced the mycelial growth of the pathogen, ranging from 32% to 51%, compared to the control, whereas no inhibitory effect was observed in the presence of Messenger (R). (C) 2010 Elsevier Ltd. All rights reserved.