Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Metal complexes with atropisomeric sulfur ligands in asymmetric hydroformylation X-ray structure of [Rh2(μ-biphes)(cod)2] (H2biphes = 4,4′-biphenanthrene-3,3′-dithiol)

The addition of the atropisomeric racemic sulfur compound 4,4′-biphenanthrene-3,3′-dithiol (H2 biphes) to a dichloromethane solution of [{M(μ-OMe)(cod)}2] (M = Rh, Ir, cod = cycloocta-1,5-diene) afforded the dithiolate-bridged complexes [{Rh2(μ-biphes)(cod)2}n] (n = 2 5 or n = 1 6) and [{Ir2(μ-biphes)(cod)2}n]·nCH2Cl27. When 1,1′-binaphthalene-2,2′-dithiol (H2 binas) reacted with [{Ir(μ-OMe)(cod)}2], complex [Ir2(μ-binas)(cod)2] 8 was obtained. Complexes 5 and 6 reacted with carbon monoxide to give the dinuclear tetracarbonyl complex [Rh2(μ-biphes)(CO)4] 9. The reaction of 9 with PR3 provided the mixed-ligand complexes [{Rh2(μ-biphes)(CO)2(PR3)2}2] · xCH2Cl2 (R = Ph, x = 2 10, C6H11, x = 1 11) and [{Rh2(μ-biphes)(CO)3(PR3)}2] · CH2Cl212 (R = OC6H4But-o). The crystal structure of 6 was determined by X-ray diffraction. Reaction of the dithioether ligand Me2biphes with [Rh(cod)2]ClO4 in CH2Cl2 solution afforded the cationic complex [Rh(cod)(Me2biphes)]ClO4 · CH2Cl213. Asymmetric hydroformylation of styrene was performed using the complexes described. The extent of aldehyde conversion ranges from 53 to 100%, with selectivities towards branched aldehydes in the range 51 to 96%. The enantioselectivities were quite low and did not exceed 20%.

Penciclovir solubility in Eudragit films: a comparison of X-ray, thermal, microscopic and release rate techniques

The solubility of penciclovir (C10N5O3H17) in a novel film formulation designed for the treatment of cold sores was determined using X-ray, thermal, microscopic and release rate techniques. Solubilities of 0.15–0.23, 0.44, 0.53 and 0.42% (w/w) resulted for each procedure. Linear calibration lines were achieved for experimentally and theoretically determined differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) data. Intra- and inter-batch data precision values were determined; intra values were more precise. Microscopy was additionally useful for examining crystal shape, size distribution and homogeneity of drug distribution within the film. Whereas DSC also determined melting point, XRPD identified polymorphs and release data provided relevant kinetics.

Unraveling the electronic structures of low-valent naphthalene and anthracene iron complexes: x-ray, spectroscopic, and density functional theory studies

Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

New Ni(II)-sulfonamide complexes: Synthesis, structural characterization and antibacterial properties. X-ray diffraction of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)]

The synthesis, structural characterization, voltammetric experiments and antibacterial activity of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] were studied and compared with similar previously reported copper complexes. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O crystallized in a monoclinic system, space group C2/c where the nickel ion was in a slightly distorted octahedral environment, coordinated with two sulfisoxazole molecules through the heterocyclic nitrogen and four water molecules. [Ni(sulfapyridine)(2)] crystallized in a orthorhombic crystal system, space group Pnab. The nickel ion was in a distorted octahedral environment, coordinated by two aryl amine N from two sulfonamides acting as monodentate ligands and four N atoms (two sulfonamidic N and two heterocyclic N) from two different sulfonamide molecules acting as bidentate ligands. Differential pulse voltammograms were recorded showing irreversible peaks at 1040 and 1070 mV, respectively, attributed to Ni(II)/Ni(III) process. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] presented different antibacterial behavior against Staphylococcus aureus and Escherichia coli from the similar copper complexes and they were inactive against Mycobacterium tuberculosis. (c) 2007 Elsevier Inc. All rights reserved.

Antimycobacterial and antitumor activities of Palladium(II) complexes containing isonicotinamide (isn): X-ray structure of trans-[Pd(N(3))(2)(isn)(2)]

Complexes of the type trans-[PdX(2)(isn)(2)] {X = Cl (1), N(3) (2), SCN (3), NCO (4); isn = isonicotinamide} were synthesized and evaluated for in vitro antimycobacterial and antitumor activities. The coordination mode of the isonicotinamide and the pseudohalide ligands was inferred by IR spectroscopy. Single crystal X-ray diffraction determination on 2 showed that coordination geometry around Pd(II) is nearly square planar, with the ligands in a trans configuration. All the compounds demonstrated better in vitro activity against Mycobacterium tuberculosis than isonicotinamide and pyrazinamide. Among the complexes, compound 2 was found to be the most active with MIC of 35.89 mu M. Complexes 1-4 were also screened for their in vitro antitumor activity towards LM3 and LP07 murine cancer cell lines. (C) 2010 Elsevier Masson SAS. All rights reserved.

A powder X-ray diffraction method for detection of polyprenylated benzophenones in plant extracts associated with HPLC for quantitative analysis

A robust, direct, rapid and non-destructive X-ray diffraction crystallography method to detect the polyprenylated benzophenones 7-epi-clusianone (1) and guttiferone A (2) in extracts from Garcinia brasiliensis is presented. Powder samples of benzophenones 1 and 2, dried hexane extracts from G. brasiliensis seeds and fruit`s pericarp, and the dried ethanolic extract from G. brasiliensis seeds were unambiguously characterized by powder X-ray diffractometry. The calculated X-ray diffraction peaks from crystal structures of analytes 1 and 2, previously determined by single-crystal X-ray diffraction technique, were overlaid to those of the experimental powder diffractograms, providing a practical identification of these compounds in the analyzed material and confirming the pure contents of the powder samples. Using the X-ray diffraction crystallography method, the studied polyprenylated benzophenones were selectively and simultaneously detected in the extracts which were mounted directly on sample holder. In addition, reference materials of the analytes were not required for analyses since the crystal structures of the compounds are known. High performance liquid chromatography analyses also were comparatively carried out to quantify the analytes in the same plant extracts showing to be in agreement with X-ray diffraction crystallography method. (C) 2010 Elsevier B.V. All rights reserved.

Molecular Basis of the Thermostability and Thermophilicity of Laminarinases: X-ray Structure of the Hyperthermostable Laminarinase from Rhodothermus marinus and Molecular Dynamics Simulations

Glycosyl hydrolases are enzymes capable of breaking the glycosidic linkage of polysaccharides and have considerable industrial and biotechnological applications. Driven by the later applications, it is frequently desirable that glycosyl hydrolases display stability and activity under extreme environment conditions, such as high temperatures and extreme pHs. Here, we present X-ray structure of the hyperthermophilic laminarinase from Rhodothermus marinus (RmLamR) determined at 1.95 angstrom resolution and molecular dynamics simulation studies aimed to comprehend the molecular basis, for the thermal stability of this class of enzymes. As most thermostable proteins, RmLamR contains a relatively large number of salt bridges, which are not randomly distributed on the structure. On the contrary, they form clusters interconnecting beta-sheets of the catalytic domain. Not all salt bridges, however, are beneficial for the protein thermostability: the existence of charge-charge interactions permeating the hydrophobic core of the enzymes actually contributes to destabilize the structure by facilitating water penetration into hydrophobic cavities, as can be seen in the case of mesophilic enzymes. Furthermore, we demonstrate that the mobility of the side-chains is perturbed differently in each class of enzymes. The side-chains of loop residues surrounding the catalytic cleft in the mesophilic laminarinase gain mobility and obstruct the active site at high temperature. By contrast, thermophilic laminarinases preserve their active site flexibility, and the active-site cleft remains accessible for recognition of polysaccharide substrates even at high temperatures. The present results provide structural insights into the role played by salt-bridges and active site flexibility on protein thermal stability and may be relevant for other classes of proteins, particularly glycosyl hydrolases.

A combined X-ray and theoretical study of flavonoid compounds with anti-inflammatory activity

The structure of 7,4`-dimethoxy-3`-acetylflavone (tithonin-Ac) has been determined by X-ray diffraction and its geometry is compared with optimized geometrical parameters obtained by means of density functional theory at the B3LYP/6-311++G(d,p) level of calculation. in addition, vertical ionization potential (IPv) and acidity for tithonin-Ac and two derivatives have been also calculated. Calculations of spin densities were also performed for the radical formed by the electron abstraction of other flavones. The unpaired electron is located on C3 carbon atom (21-25%). (C) 2008 Elsevier B.V. All rights reserved.

Synthesis, spectroscopic characterization and X-ray structures of five-coordinate diorganotin(IV) complexes containing 5-hydroxypyrazoline derivatives as ligands

Four new diorganotin(IV) complexes have been prepared from R(2)SnCl(2) (R = Me, Ph) with the ligands 5-hydroxy-3-metyl-5-phenyl-1-(S-benzildithiocarbazate)-pyrazoline (H(2)L(1)) and 5-hydroxy-3-methyl-5-phenyl-1-(2-thiophenecarboxylic)-pyrazoline (H(2)L(2)). The complexes were characterized by elemental analysis, IR. (1)H (13)C, (119)Sn NMR and Mossbauer spectroscopes The complexes [Me(2)SnL(1)], [Ph(2)SnL(1)] and [Me(2)SnL(2)] were also studied by single crystal X-ray diffraction and the results showed that the Sn(IV) central atom of the complexes adopts a distorted trigonal bipyramidal (TBP) geometry with the N atom of the ONX-tridentate (X = O and S) ligand and two organic groups occupying equatorial sites. The C-Sn-C angles for [Me(2)Sn(L(1))] and [Ph(2)Sn(L(1))] were calculated using a correlation between (119)Sn Mossbauer and X-ray crystallographic data based on the point-charge model Theoretical calculations were performed with the B3LYP density functional employing 3-21G(*) and DZVP all electron basis sets showing good agreement with experimental findings General and Sn(IV) specific IR harmonic frequency scale factors for both basis sets were obtained from comparison with selected experimental frequencies (C) 2010 Elsevier B V All rights reserved

Cationic and neutral phenylmercury(II) complexes with heterocyclic thione ligands. X-ray structures of [HgPh(dmpymtH)][BF(4)] center dot H(2)O and [{HgPh}(2)(mu-dtu)]

The neutral complex [HgPh(dmpymt)] 1 (dmpymtH = 4,6-dimethylpyrimidine-2(1H)-thione) reacts with HBF(4) to give the cationic complex [HgPh(dmpymtH)][BF(4)] 2. The X-ray molecular structure of the later revealed a [2+1] coordination sphere about the mercury(II) atom (C-Hg-S and Hg center dot center dot center dot N). In the dinuclear complex [(HgPh)(2)(mu-dtu)] 3 [dtuH(2) = 2,4(1H,3H)-pyrimidinedithione or dithiouracil] the coordination spheres are also [2+1] although dissimilar regarding the Hg center dot center dot center dot N secondary bonds. NMR spectroscopy ((1)H, (13)C and (199)Hg) studies were undertaken in solution and the results discussed in the light of the X-ray structures. (C) 2008 Elsevier B. V. All rights reserved.

Antitumor and antimycobacterial activities of cyclopalladated complexes: X-ray structure of [Pd(C-2,N-dmba)(Br)(tu)] (dmba = N,N-dimethylbenzylamine, tu = thiourea)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Antimycobacterial and antitumor activities of Palladium(II) complexes containing isonicotinamide (isn): X-ray structure of trans-[Pd(N-3)(2)(isn)(2)]

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)