931 resultados para Specific protein(s)
Electrostatic supramolecular assembly of charged dendritic polymers and their biological application
Resumo:
The aim of this study was the development of functional multilayer films through electrostatic layer by layer (LbL) assembly of dendritic macromolecules, the investigation of the fundamental properties of these multilalyered films and the study of their biological applications. rnThe synthesis of the anionic hyperbranched polyglycerols (hbPG) and the preparation of multilayers made of hbPG/phosphorus dendrimer as well as the influences of deposition conditions on multilayers were reported. The thicknesses of multilayer films increase with a decrease of molecular weight of anionic hbPGs. The multilayer films fabricated by low molecular weight hbPGs grow less regularly due to the less charged carboxylic acid groups providing the relative weaker electrostatic forces for the deposition. The thicknesses of multilayer films are reduced with increasing pH values and decreasing the concentration of NaCl. The observed changes of multilayer thickness and surface morphology could be interpreted with the aid of theories regarding the charge density and conformation of the anionic hbPG chains in solution. rnBesides the study of fundamental properties of hbPG/phosphorus multilayer films, antifouling thin films derived from hbPG layers were developed. The antifouling properties of hbPG layers were found to correlate with factors of the molecular weight of anionic hbPG and the film thickness. It was demonstrated that anionic hbPG single layer with highest molecular weight can reduce non specific protein adsorption more efficiently than single layer with lower molecular weight and all the hbPG bilayers possessed excellent property of antifouling. rnPhosphorus dendrimer multilayers were successfully prepared as the platforms to detect DNA immobilization and hybridization. The effect of NaCl concentration on the multilayer film thickness was evaluated to obtain the optimized film thickness. Making use of the multilayer deposited at the optimized condition as a substrate, a high loading of DNA probes was achieved through covalent coupling of probe DNA with the as-formed multilayer films. The hybridization of target DNA with immobilized probe DNA was then carried out and studied by SPFS. The limit of detection upon hybridization was estimated on various dendrimer multilayer platforms. The minimum detection concentration for DNA hybridization is in the same order of magnitude compared with other neutral phosphorus dendrimer systems. Furthermore, the LbL deposition of phosphorus dendrimer multilayers provided a mild and simple way to prepare platforms as DNA microarrays. rnBased on the phosphorus dendrimer multilayer systems, dendritic star polymers were employed which have more reactive groups than that phosphorus dendrimers. The as-assembled dendritic star polymer multilayer films exhibited such distinct morphology characteristics that they underwent extensive structural reorganization upon post-treatment under different pH conditions. Kinetic binding of probe DNA molecules on the outermost negatively charged dendritic surface was studied by SPR as well. The binding capacities of probe DNA on the multilayer surfaces fabricated from the first-generation and the second-generation of dendritic star polymers were compared. The improved binding capacity was achieved from the second-generation of dendritic star polymer multilayer films due to their more reactive groups. DNA hybridization reaction on dendritic multilayer films was investigated by SPFS. The similar hybridization behaviors were found on both multilayer surfaces. Meanwhile, the hybridization kinetic affinities were compared with that of phosphorus dendrimer multilayer surfaces and showed improved detection sensitivity than phosphorus dendrimer multilayer films.rn
Resumo:
In der vorliegenden Arbeit wurden Zielstrukturen autologer, tumorreaktiver CD8+ T-Zellen im Modell des Melanompatienten D41 charakterisiert, der im metastasierten Stadium nach Vakzinierung mit autologen dendritischen Zellen und bestrahlten Tumorzellen eine dauerhafte komplette Remission erreichte (O´Rourke et al., Melanoma Res. 17:316, 2007). Aus kryokonservierten Blutlymphozyten verschiedener Zeitpunkte wurden durch Stimulation mit autologen Tumorzellen (D41-MEL) in unabhängigen gemischten Lymphozyten-/Tumorzell-Kulturen (MLTCs) tumorreaktive CD8+ T-Zellen angereichert. Als Erstes wurde überprüft, ob sie gegen bekannte Melanomantigene in Assoziation mit den HLA-Klasse I-Allelen des Patienten gerichtet waren. Dabei zeigten sich Reaktivitäten gegen das melanosomale Differenzierungsantigen Melan-A mit HLA-A*0201 und darüber hinaus gegen die Cancer/Testis-Antigene (CTA) MAGE-A3 und MAGE-A6 mit HLA-A*0101, sowie NY-ESO-1, MAGE-A4 und MAGE-A10 mit HLA-A*0201. In einem zweiten Schritt wurde mit T-Zell-Klonen aus D41-MLTC 2, die keines dieser Antigene erkannten, eine cDNA-Expressionsbank von D41-MEL gescreent. Dies führte zur Klonierung einer für TSPY 1 (testis-specific protein Y-encoded 1) kodierenden cDNA mit einem der T-Zell-Klone. Er erkannte mit hoher Affinität die synthetischen TSPY 1-Peptide LLDDIMAEV (Aminosäurepositionen 66-73) und LLLDDIMAEV (Aminosäurepositionen 65-73) in Assoziation mit HLA-A*0201. Serologische Immunantworten gegen das als CTA einzustufende TSPY 1 sind bekannt. In der vorliegenden Arbeit wurde erstmals eine T-Zell-Antwort gegen TSPY 1 nachgewiesen. TSPY 1 trägt mutmaßlich zu Entstehung des Gonadoblastoms bei, seine Expression wurde jedoch z.B. auch in Seminomen, Leberzellkarzinomen und Melanomen nachgewiesen. Die Expression von TSPY 1 in der Zelllinie D41-MEL-Zellen war sehr heterogen. Einzelne Klone der Linie exprimierten TSPY 1 auf stabil hohem, andere Klone auf ebenso stabil intermediärem bzw. nicht detektierbarem Niveau. Die Expression und die Erkennung durch TSPY 1-reaktive T-Zell-Klone wurde durch die demethylierende Substanz 5-Aza-2´-deoxycytidine gesteigert. Dies spricht für eine Promotor-Hypermethylierung als Ursache fehlender bzw. niedriger Expression, wie dies für verschiedene CTA zutrifft. Die im Blut des Patienten D41 detektierbare antitumorale T-Zell-Reaktivität war bereits vor der Vakzinierung mit Tumorzellen nachweisbar und hatte sich somit spontan entwickelt. Ihre Individualität war vorgegeben durch das Antigenexpressionsmuster der D41-Tumorzellen, sowie durch den HLA-Phänotyp und mutmaßlich auch das T-Zellrepertoire des Patienten. Die detaillierte Analyse komplexer antitumoraler T-Zellantworten legt den Grundstein für eine Immuntherapie, die sich auf das tatsächliche Potential des individuellen T-Zellsystems stützen kann.
Resumo:
KurzfassungrnrnZiel der vorliegenden Arbeit war es eine gezielte, hochspezifische Inhibierung der Proteinbiosynthese zu erreichen. Dies kann durch eine Blockierung des mRNA-Strangs durch komplementäre DNA/RNA-Stränge (ähnlich zur Antisense-Methode) oder durch die Hydrolyse des mRNA-Strangs mit Hilfe spezieller Enzyme (RNasen) realisiert werden. Da jedoch beide Methoden nicht zu zufriedenstellenden Ergebnissen führen, wäre deshalb eine Kombination aus beiden Methoden ideal, welche in einer spezifischen, gezielten und permanenten Ausschaltung der Proteinbiosynthese resultieren würde. Um dieses Ziel zu verwirklichen, ist es nötig, ein Molekül zu synthetisieren, welches in der Lage ist selektiv an einer spezifischen Position an den RNA-Strang zu hybridisieren und anschließend den RNA-Strang an dieser zu hydrolysieren. Der große Vorteil dieses Konzepts liegt darin, dass die DNA-Sequenz für die Hybridisierung an die entsprechende RNA maßgeschneidert hergestellt werden kann und somit jede RNA gezielt angesteuert werden kann, was letztendlich zu einer spezifischen Inhibierung der korrespondierenden Proteinbiosynthese führen soll.rnDurch die Verwendung und Optimierung der Nativen Chemischen Ligation (NCL) als Konjugationsmethode konnten zwei Biomakromoleküle in Form einer 46-basenlangen DNA (komplementär zum RNA-Strang) und einer 31-aminosäurelangen RNase kovalent verknüpft werden. Durch unterschiedliche chemische und molekularbiologische Analysemethoden, wie PAGE, GPC, CE, MALDI-ToF-MS etc., war es zudem möglich, die erfolgreiche Synthese dieses biologischen Hybridpolymers als monodisperses, reines Produkt zu bestätigen. rnDie Synthese des ca. 800-basenlangen RNA-Strangs, der als Modell-Matrize für die selektive und spezifische Degradierung durch das DNA-RNase-Konjugat dienen sollte, konnte unter Zuhilfenahme gentechnologischer Standard-Methoden erfolgreich bewerkstelligt werden. Weiterhin konnte durch die Verwendung der radioaktiven cDNA-Synthese gezeigt werden, dass das DNA-RNase-Konjugat an die gewünschte Stelle des RNA-Strangs hybridisiert. Die Identifizierung einer anschließenden spezifischen Hydrolyse des RNA-Strangs durch die an den DNA-Strang angeknüpfte RNase war aufgrund der geringen katalytischen Aktivität des Enzyms bisher allerdings nicht möglich.rn
Resumo:
A high percentage of oesophageal adenocarcinomas show an aggressive clinical behaviour with a significant resistance to chemotherapy. Heat-shock proteins (HSPs) and glucose-regulated proteins (GRPs) are molecular chaperones that play an important role in tumour biology. Recently, novel therapeutic approaches targeting HSP90/GRP94 have been introduced for treating cancer. We performed a comprehensive investigation of HSP and GRP expression including HSP27, phosphorylated (p)-HSP27((Ser15)), p-HSP27((Ser78)), p-HSP27((Ser82)), HSP60, HSP70, HSP90, GRP78 and GRP94 in 92 primary resected oesophageal adenocarcinomas by using reverse phase protein arrays (RPPA), immunohistochemistry (IHC) and real-time quantitative RT-PCR (qPCR). Results were correlated with pathologic features and survival. HSP/GRP protein and mRNA expression was detected in all tumours at various levels. Unsupervised hierarchical clustering showed two distinct groups of tumours with specific protein expression patterns: The hallmark of the first group was a high expression of p-HSP27((Ser15, Ser78, Ser82)) and low expression of GRP78, GRP94 and HSP60. The second group showed the inverse pattern with low p-HSP27 and high GRP78, GRP94 and HSP60 expression. The clinical outcome for patients from the first group was significantly improved compared to patients from the second group, both in univariate analysis (p = 0.015) and multivariate analysis (p = 0.029). Interestingly, these two groups could not be distinguished by immunohistochemistry or qPCR analysis. In summary, two distinct and prognostic relevant HSP/GRP protein expression patterns in adenocarcinomas of the oesophagus were detected by RPPA. Our approach may be helpful for identifying candidates for specific HSP/GRP-targeted therapies.
Resumo:
Theileria annulata and T. parva are closely related protozoan parasites that cause lymphoproliferative diseases of cattle. We sequenced the genome of T. annulata and compared it with that of T. parva to understand the mechanisms underlying transformation and tropism. Despite high conservation of gene sequences and synteny, the analysis reveals unequally expanded gene families and species-specific genes. We also identify divergent families of putative secreted polypeptides that may reduce immune recognition, candidate regulators of host-cell transformation, and a Theileria-specific protein domain [frequently associated in Theileria (FAINT)] present in a large number of secreted proteins.
Resumo:
Echicetin, a heterodimeric snake C-type lectin from Echis carinatus, is known to bind specifically to platelet glycoprotein (GP)Ib. We now show that, in addition, it agglutinates platelets in plasma and induces platelet signal transduction. The agglutination is caused by binding to a specific protein in plasma. The protein was isolated from plasma and shown to cause platelet agglutination when added to washed platelets in the presence of echicetin. It was identified as immunoglobulin Mkappa (IgMkappa) by peptide sequencing and dot blotting with specific heavy and light chain anti-immunoglobulin reagents. Platelet agglutination by clustering echicetin with IgMkappa induced P-selectin expression and activation of GPIIb/IIIa as well as tyrosine phosphorylation of several signal transduction molecules, including p53/56(LYN), p64, p72(SYK), p70 to p90, and p120. However, neither ethylenediaminetetraacetic acid nor specific inhibition of GPIIb/IIIa affected platelet agglutination or activation by echicetin. Platelet agglutination and induction of signal transduction could also be produced by cross-linking biotinylated echicetin with avidin. These data indicate that clustering of GPIb alone is sufficient to activate platelets. In vivo, echicetin probably activates platelets rather than inhibits platelet activation, as previously proposed, accounting for the observed induction of thrombocytopenia.
Resumo:
BACKGROUND: Eosinophil differentiation, activation, and survival are largely regulated by IL-5. IL-5-mediated transmembrane signal transduction involves both Lyn-mitogen-activated protein kinases and Janus kinase 2-signal transducer and activator of transcription pathways. OBJECTIVE: We sought to determine whether additional signaling molecules/pathways are critically involved in IL-5-mediated eosinophil survival. METHODS: Eosinophil survival and apoptosis were measured in the presence and absence of IL-5 and defined pharmacologic inhibitors in vitro. The specific role of the serine/threonine kinase proviral integration site for Moloney murine leukemia virus (Pim) 1 was tested by using HIV-transactivator of transcription fusion proteins containing wild-type Pim-1 or a dominant-negative form of Pim-1. The expression of Pim-1 in eosinophils was analyzed by means of immunoblotting and immunofluorescence. RESULTS: Although pharmacologic inhibition of phosphatidylinositol-3 kinase (PI3K) by LY294002, wortmannin, or the selective PI3K p110delta isoform inhibitor IC87114 was successful in each case, only LY294002 blocked increased IL-5-mediated eosinophil survival. This suggested that LY294002 inhibited another kinase that is critically involved in this process in addition to PI3K. Indeed, Pim-1 was rapidly and strongly expressed in eosinophils after IL-5 stimulation in vitro and readily detected in eosinophils under inflammatory conditions in vivo. Moreover, by using specific protein transfer, we identified Pim-1 as a critical element in IL-5-mediated antiapoptotic signaling in eosinophils. CONCLUSIONS: Pim-1, but not PI3K, plays a major role in IL-5-mediated antiapoptotic signaling in eosinophils.
Resumo:
The tumor microenvironment is comprised of a vast array of heterogeneous cells including both normal and neoplastic cells. The tumor stroma recruitment process has been exploited for an effective gene delivery technique using bone marrow derived MSC. Targeted migration of the MSC toward the tumor microenvironment, while successful, is not yet fully understood. This study was designed to assess the role of CD44 in the migration of MSC toward the tumor microenvironment and to determine the implications of CD44-deficient MSC within the tumor stroma. Inhibition of MSC migration was evaluated through a variety of methods in vitro and in vivo including CD44 receptor knockdown, CD44 antagonists, CD44 neutralizing antibodies and small molecule inhibitor of matrix metalloproteinases. Blocking CD44 signaling through MMP inhibition was characterized by lack of intracellular domain cleavage and lead to the decrease in Twist gene expression. A functional relationship between CD44 and Twist expression was confirmed by chromatin immunoprecipitation. Next, a series of murine tumor models were used to examine the role of CD44 deficient stroma within the tumor microenvironment. Labeled transgenic CD44 knockout (KO) MSC or wild type (WT) C57/B6 MSC were used to analyze the stromal incorporation within murine breast carcinomas (EO771 and 4T1). Subsequent tumors were analyzed for vessel formation (CD31), and the presence of tumor associated fibroblast (TAF) markers, α-smooth muscle actin (α-SMA), fibroblast activation protein (FAP), and fibroblast specific protein (FSP). The tumors with CD44KO MSC cells had less vessel formation than the tumors with WT MSC. The lack of fibroblastic TAF population as defined by FAP/FSP expression by the CD44KO MSC admixed tumors suggest that the bone marrow derived population of MSC were unable to contribute to the fibroblastic stromal population. Subsequently, a bone marrow transplantation experiment confirmed the endogenous migratory deficiencies of the CD44KO bone marrow derived stromal cells toward the tumor microenvironment in vivo. WT mice with CD44KO bone marrow had less CD44KOderived tumor stroma compared to mice with WT bone marrow. These results indicate that CD44 is crucial to stromal cell migration and incorporation to the tumor microenvironment as TAF.
Resumo:
Neonatal and adult cardiomyocytes were isolated from rat hearts. Some of the adult myocytes were cultured to allow for cell dedifferentiation, a phenomenon thought to mimic cell changes that occur in stressed myocardium, with myocytes regressing to a fetal pattern of metabolism and stellate neonatal shape.Using fluorescence deconvolution microscopy, cells were probed with fluorescent markers and scanned for a number of proteins associated with ion control, calcium movements and cardiac function. Image analysis of deconvoluted image stacks and sequential real-time image recordings of calcium transients of cells were made.All three myocyte groups were predominantly comprised of binucleate cells. Clustering of proteins to a single nucleus was a common observation, suggesting that one nucleus is active in protein synthesis pathways, while the other nucleus assumes a 'dormant' or different role and that cardiomyocytes might be mitotically active even in late development, or specific protein syntheses could be targeted and regulated for reintroduction into the cell cycle.Such possibilities would extend cardiac disease associated stem cell research and therapy options, while producing valuable insights into developmental and death pathways of binucleate cardiomyocytes (word count 183).
Resumo:
The Bcr-Abl fusion oncogene which resulted from a balanced reciprocal translocation between chromosome 9 and 22, t(9;22)(q11, q34), encodes a 210 KD elevated tyrosine specific protein kinase that is found in more than 95 percent of chronic myelogenous leukemia patients (CML). Increase of level of phosphorylation of tyrosine is observed on cell cycle regulatory proteins in cells overexpressing the Bcr-Abl oncogene, which activates multiple signaling pathways. In addition, distinct signals are required for transforming susceptible fibroblast and hematopoietic cells, and the minimal signals essential for transforming hematopoietic cells are yet to be defined. In the present study, we first established a tetracycline repressible p210$\rm\sp{bcr-abl}$ expression system in a murine myeloid cell line 32D c13, which depends on IL3 to grow in the presence of tetracycline and proliferate independent of IL3 in the absence of tetracycline. Interestingly, one of these sublines does not form tumors in athymic nude mice suggesting that these cells may not be completely transformed. These cells also exhibit a dose-dependent growth and expression of p210$\rm\sp{bcr-abl}$ at varying concentrations of tetracycline in the culture. However, p210$\rm\sp{bcr-abl}$ rescues IL3 deprivation induced apoptosis in a non-dose dependent fashion. DNA genotoxic damage induced by gamma-irradiation activates c-Abl tyrosine kinase, the cellular homologue of p210$\rm\sp{bcr-abl},$ and leads to activation of p38 MAP kinase in the cells. However, in the presence of p210$\rm\sp{bcr-abl}$ the irradiation failed to activate the p38 MAP kinase as examined by an antibody against phosphorylated p38 MAP kinase. Similarly, an altered tyrosine phosphorylation of the JAK1-STAT1 pathways was identified in cells constitutively overexpressing p210$\rm\sp{bcr-abl}.$ This may provided a molecular mechanism for altered therapeutic response of CML patients to IFN-$\alpha.$^ Bcr-Abl oncoprotein has multiple functional domains which have been identified by the work of others. The Bcr tetramerization domain, which may function to stabilize the association of the Bcr-Abl with actin filaments in p210$\rm\sp{bcr-abl}$ susceptible cells, are essential for transforming both fibroblast and hematopoietic cells. We designed a transcription unit encoding first 160 amino acids polypeptide of Bcr protein to test if this polypeptide can inhibit the transforming activity of the p210$\rm\sp{bcr-abl}$ oncoprotein in the 32D c13 cells. When this vector was transfected transiently along with the p210$\rm\sp{bcr-abl}$ expression vector, it can block the transforming activity of p210$\rm\sp{bcr-abl}.$ On the other hand, the retinoblastoma tumor suppressor protein (Rb), a naturally occurring negative regulator of the c-Abl kinase, the cellular homologue of Bcr-Abl oncoprotein, binds to and inhibits the c-Abl kinase in a cell cycle dependent manner. A polypeptide obtained from the carboxyl terminal end of the retinoblastoma tumor suppressor protein, in which the nuclear localization signal was mutated, was used to inhibit the kinase activity of the p210$\rm\sp{bcr-abl}$ in the cytoplasm. This polypeptide, called Rb MC-box, and its wild type form, Rb C-box, when overexpressed in the 32D cells are mainly localized in the cytoplasm. Cotransfection of a plasmid transcription unit coding for this polypeptide and the gene for the p210$\rm\sp{bcr-abl}$ resulted in reduced plating efficiency of p210$\rm\sp{bcr-abl}$ transfected IL3 independent 32D cells. Together, these results may lead to a molecular approach to therapy of CML and an in vitro assay system to identify new targets to which an inhibitory polypeptide transcription unit may be directed. ^
Resumo:
Osteopontin (OPN) is a highly-phosphorylated extracellular matrix protein localized in bone, kidney, placenta, T-lymphocytes, macrophages, smooth muscle of the vascular system, milk, urine, and plasma. In ROS 17/2.8 osteoblast-like osteosarcoma cells, 1,25-dihydroxyvitamin D3 [1,25(OH)2D 3] regulates OPN at the transcriptional level resulting in increased steady state mRNA levels and increased production of OPN protein, maximal at 48 hours. Using ROS 17/2.8 cells as an osteoblast model, OPN was purified from culture medium after three hour treatments of either vehicle (ethanol) or 1,25(OH)2D3 via barium citrate precipitation followed by immunoaffinity chromatography. ^ Here, further evidence of regulation of OPN by 1,25(OH)2D 3 at the posttranslational level is presented. Prior to the up-regulation of OPN at the transcriptional level, 1,25(OH)2D3 induces a shift in OPN isoelectric point (pI) detected on two-dimensional gels from pI 4.6 to pI 5.1. Loading equal amounts of [32P]-labeled OPN recovered from ROS 17/2.8 cells exposed to 1,25(OH)2D3 or vehicle alone for three hours reveals that the shift from pI 4.6 to 5.1 is the result of reduced phosphorylation. Using structural analogs to 1,25(OH) 2D3, analog AT [25-(OH)-16-ene-23-yne-D3], which triggers Ca2+ influx through voltage sensitive Ca2+ channels but does not bind to the vitamin D receptor, mimicked the OPN pI shift while analog BT [1,25(OH)2-22-ene-24-cyclopropyl-D 3], which binds to the vitamin D receptor but does not allow Ca 2+ influx, did not. Inclusion of the Ca2+ channel blocker nifedipine also blocks the charge shift conversion of OPN. Further analysis of the signaling pathway initiated by 1,25(OH)2D3 reveals that inhibition of the cyclic 3′,5′ -adenosine monophosphate-dependent kinase, protein kinase A, or inhibition of the cyclic 3′,5′-guanine monophosphate-dependent kinase, protein kinase G, also prevents the charge shift conversion. ^ Isolation of OPN from rat femurs and tibiae provides evidence for the existence of these two OPN charge forms in vivo, evidenced by differential migration on isoelectric focusing gels and sodium dodecyl sulfate-polyacrylamide gels. Peptide sequencing of rat long bone fractions revealed the presence of a presumed dentin specific protein, dentin matrix protein-1 (DMP-1). Western blot analysis confirmed the existence of DMP-1 in these fractions. ^ Using the OPN charge forms in functional assays, it was determined that the charge forms have differential roles in both cell surface and mineralization functions. In cell attachment assays and Ca2+ influx assays using PC-3 prostate cancer cells, the pI 5.1 charge form of OPN was found to permit binding and increase intracellular Ca2+ concentrations of PC-3 cells. The increase in intracellular Ca2+ concentration was found to be integrin αvβ3-dependent. In mineralization assays, the pI 4.6 charge form of OPN promoted hydroxyapatite formation, while the pI 5.1 charge form had improved Ca2+ binding ability. ^ In conclusion, these findings suggest that 1,25(OH) 2D3 regulates OPN not only at the transcriptional level, but also plays a role in determination of the OPN phosphorylation state. The latter involves a short term (less than three hours) treatment and is associated with membrane-initiated Ca2+ influx. Functional assays utilizing the two OPN charge forms reveal the dependence of OPN post-translational state on its function. ^
Resumo:
In Xenopus oocytes in vitro transcribed mouse U7 RNA is assembled into small nuclear ribonucleoproteins (snRNPs) that are functional in histone RNA 3' processing. If the special Sm binding site of U7 (AAUUUGUCUAG, U7 Sm WT) is converted into the canonical Sm sequence derived from the major snRNAs (AAUUUUUGGAG, U7 Sm OPT) the RNA assembles into a particle which accumulates more efficiently in the nucleus, but which is non-functional. U7 RNA with a heavily mutated Sm binding site (AACGCGUCAUG, U7 Sm MUT) is deficient in nuclear accumulation and function. By UV cross-linking U7 Sm WT RNA can be linked to three proteins, i.e. the common snRNP proteins G and B/B' and an apparently U7-specific protein of 40 kDa. As a result of altering the Sm binding site, U7 Sm OPT RNA cannot be cross-linked to the 40 kDa protein and no cross-links are obtained with U7 Sm MUT RNA. The fact that the Sm site also interacts with at least one U7-specific protein is so far unique to U7 RNA and may provide an explanation for the atypical sequence of this site. All described RNA-protein interactions, including that with the 40 kDa protein, already occur in the cytoplasm. An additional cytoplasmic photoadduct obtained with U7 Sm WT and U7 Sm OPT, but not U7 Sm MUT, RNAs is indicative of a protein of 60-80 kDa. The m7G cap structure of U7 Sm WT and U7 Sm OPT RNA becomes hypermethylated. However, the 3mG cap enhances, but is not required for, nuclear accumulation. Finally, U7 Sm WT RNA is functional in histone RNA processing even when bearing an ApppG cap.
Resumo:
To meet the requirements for rapid tumor growth, a complex array of non-neoplastic vascular, fibroblastic, and immune cells are recruited to the tumor microenvironment. Understanding the origin, composition, and mechanism(s) for recruitment of these stromal components will help identify areas for therapeutic intervention. Previous findings have suggested that ex-vivo expanded bone marrow-derived MSC home to the sites of tumor development, responding to inflammatory signals and can serve as effective drug delivery vehicles. Therefore, we first sought to fully assess conditions under which MSC migrate to and incorporate into inflammatory microenvironments and the consequences of modulated inflammation. MSC delivered to animals bearing inflammatory insults were monitored by bioluminescence imaging and displayed specific tropism and selective incorporation into all tumor and wound sites. These findings were consistent across routes of tumor establishment, MSC administration, and immunocompetence. MSC were then used as drug delivery vehicles, transporting Interferon β to sites of pancreatic tumors. This therapy was effective at inhibiting pancreatic tumor growth under homeostatic conditions, but inhibition was lost when inflammation was decreased with CDDO-Me combination treatment. Next, to examine the endogenous tumor microenvironment, a series of tissue transplant experiments were carried out in which tissues were genetically labeled and engrafted in recipients prior to tumor establishment. Tumors were then analyzed for markers of tumor associated fibroblasts (TAF): α-smooth muscle actin (α-SMA), nerve glia antigen 2 (NG2), fibroblast activation protein (FAP), and fibroblast specific protein (FSP) as well as endothelial marker CD31 and macrophage marker F4/80. We determined the majority of α-SMA+, NG2+ and CD31+ cells were non-bone marrow derived, while most FAP+, FSP+, and F4/80+ cells were recruited from the bone marrow. In accord, transplants of prospectively isolated BM MSC prior to tumor development indicated that these cells were recruited to the tumor microenvironment and co-expressed FAP and FSP. In contrast, fat transplant experiments revealed recruited fat derived cells co-expressed α-SMA, NG2, and CD31. These results indicate TAF are a heterogeneous population composed of subpopulations with distinct tissues of origin. These models have provided a platform upon which further investigation into tumor microenvironment composition and tests for candidate drugs can be performed. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
The expression of P-glycoproteins encoded by the mdr gene family is associated with the emergence of multidrug-resistance phenotype in animal cells. This gene family includes two members, MDR1 and MDR2, in humans, and three members, mdr1a, mdr1b, and mdr2, in rodents. Among them, the rat mdr1b is known to be highly activated during hepatocarcinogenesis, and its expression is sensitive to the treatment with growth factors, cytotoxic drugs, as well as other physical or chemical stresses. It is believed that the transcriptional regulation plays an important role in above events, however little has been known about mechanisms involved.^ To elucidate how mdr1b expression is regulated, we isolated the genomic sequence of the rat mdr1b and functionally dissected its 5$\prime$ promoter region. Our results demonstrated that: (1) the transcription start site of the rat mdr1b is identical to that of the murine mdr1b homologue; (2) a palindromic sequence from bp $-$189 to $-$180 bp is essential for the basal promoter function of the rat mdr1b, and binds to a specific protein that appears to be a novel transcription factor implicated in the regulation of the rat mdr1b expression; (3) a NF-$\kappa$B-binding site from bp $-$167 to $-$159 is also involved in the basal promoter function. The p65/p50 subunits of the NF-$\kappa$B and raf-1 kinase are implicated in the insulin-inducible promoter activity of the mdr1b, suggesting the important role of NF-$\kappa$B in the regulation of the mdr1b by growth factors; (4) a p53-binding site from bp $-$199 to $-$180 is not only essential for the basal promoter activity but also responsible for the induction of mdr1b by cytotoxic agents. In addition, we provided evidence showing that endogenous mdr1b expression can be modulated by wild-type p53. On the basis of these findings, a model of transcriptional regulation of the rat mdr1b was proposed. ^