998 resultados para Skin Detection
Resumo:
Objective
Pedestrian detection under video surveillance systems has always been a hot topic in computer vision research. These systems are widely used in train stations, airports, large commercial plazas, and other public places. However, pedestrian detection remains difficult because of complex backgrounds. Given its development in recent years, the visual attention mechanism has attracted increasing attention in object detection and tracking research, and previous studies have achieved substantial progress and breakthroughs. We propose a novel pedestrian detection method based on the semantic features under the visual attention mechanism.
Method
The proposed semantic feature-based visual attention model is a spatial-temporal model that consists of two parts: the static visual attention model and the motion visual attention model. The static visual attention model in the spatial domain is constructed by combining bottom-up with top-down attention guidance. Based on the characteristics of pedestrians, the bottom-up visual attention model of Itti is improved by intensifying the orientation vectors of elementary visual features to make the visual saliency map suitable for pedestrian detection. In terms of pedestrian attributes, skin color is selected as a semantic feature for pedestrian detection. The regional and Gaussian models are adopted to construct the skin color model. Skin feature-based visual attention guidance is then proposed to complete the top-down process. The bottom-up and top-down visual attentions are linearly combined using the proper weights obtained from experiments to construct the static visual attention model in the spatial domain. The spatial-temporal visual attention model is then constructed via the motion features in the temporal domain. Based on the static visual attention model in the spatial domain, the frame difference method is combined with optical flowing to detect motion vectors. Filtering is applied to process the field of motion vectors. The saliency of motion vectors can be evaluated via motion entropy to make the selected motion feature more suitable for the spatial-temporal visual attention model.
Result
Standard datasets and practical videos are selected for the experiments. The experiments are performed on a MATLAB R2012a platform. The experimental results show that our spatial-temporal visual attention model demonstrates favorable robustness under various scenes, including indoor train station surveillance videos and outdoor scenes with swaying leaves. Our proposed model outperforms the visual attention model of Itti, the graph-based visual saliency model, the phase spectrum of quaternion Fourier transform model, and the motion channel model of Liu in terms of pedestrian detection. The proposed model achieves a 93% accuracy rate on the test video.
Conclusion
This paper proposes a novel pedestrian method based on the visual attention mechanism. A spatial-temporal visual attention model that uses low-level and semantic features is proposed to calculate the saliency map. Based on this model, the pedestrian targets can be detected through focus of attention shifts. The experimental results verify the effectiveness of the proposed attention model for detecting pedestrians.
Resumo:
This work describes preliminary results of a two-modality imaging system aimed at the early detection of breast cancer. The first technique is based on compounding conventional echographic images taken at regular angular intervals around the imaged breast. The other modality obtains tomographic images of propagation velocity using the same circular geometry. For this study, a low-cost prototype has been built. It is based on a pair of opposed 128-element, 3.2 MHz array transducers that are mechanically moved around tissue mimicking phantoms. Compounded images around 360 degrees provide improved resolution, clutter reduction, artifact suppression and reinforce the visualization of internal structures. However, refraction at the skin interface must be corrected for an accurate image compounding process. This is achieved by estimation of the interface geometry followed by computing the internal ray paths. On the other hand, sound velocity tomographic images from time of flight projections have been also obtained. Two reconstruction methods, Filtered Back Projection (FBP) and 2D Ordered Subset Expectation Maximization (2D OSEM), were used as a first attempt towards tomographic reconstruction. These methods yield useable images in short computational times that can be considered as initial estimates in subsequent more complex methods of ultrasound image reconstruction. These images may be effective to differentiate malignant and benign masses and are very promising for breast cancer screening. (C) 2015 The Authors. Published by Elsevier B.V.
Resumo:
This study describes changes in skin protection attitudes and outdoor behaviors of adults in Queensland, Australia, using two cross-sectional telephone surveys conducted in 1988/89 (N = 1699) and 1991/92 (N = 2317). After adjustment for potential confounders, there were significant improvements in some skin protection attitudes, time spent outside, hat wearing, sunscreen use, overall skin protection (p < 0.01) and shade use (p < 0.05) between 11:00 AM and 3:00 PM on the previous Sunday. The degree of attitudinal and behavioral change varied with age, gender, region, and reported skin type. However, recent sunburn experience remained unchanged. A similar study in Victoria, Australia, observed changes in skin protection attitudes, behaviors, and recent sunburn. We speculate on possible explanations for the lack of improvement in recent sunburn experience despite the improvement in skin protection attitudes, and behaviors, and suggest that part of the explanation may be environmental differences. This has implications for generalizability of such studies outside the geographical region in which they were conducted. Article in Cancer Detection and Prevention 20(6):566-75 · January 1996
Resumo:
BACKGROUND Herpesvirus and poxvirus can infect a wide range of species: herpesvirus genetic material has been detected and amplified in five species of the superfamily Pinnipedia; poxvirus genetic material, in eight species of Pinnipedia. To date, however, genetic material of these viruses has not been detected in walrus (Odobenus rosmarus), another marine mammal of the Pinnipedia clade, even though anti-herpesvirus antibodies have been detected in these animals. CASE PRESENTATION In February 2013, a 9-year-old healthy captive female Pacific walrus died unexpectedly at L'Oceanografic (Valencia, Spain). Herpesvirus was detected in pharyngeal tonsil tissue by PCR. Phylogenetic analysis revealed that the virus belongs to the subfamily Gammaherpesvirinae. Poxvirus was also detected by PCR in skin, pre-scapular and tracheobronchial lymph nodes and tonsils. Gross lesions were not detected in any tissue, but histopathological analyses of pharyngeal tonsils and lymph nodes revealed remarkable lymphoid depletion and lymphocytolysis. Similar histopathological lesions have been previously described in bovine calves infected with an alphaherpesvirus, and in northern elephant seals infected with a gammaherpesvirus that is closely related to the herpesvirus found in this case. Intracytoplasmic eosinophilic inclusion bodies, consistent with poxviral infection, were also observed in the epithelium of the tonsilar mucosa. CONCLUSION To our knowledge, this is the first molecular identification of herpesvirus and poxvirus in a walrus. Neither virus was likely to have contributed directly to the death of our animal.
Resumo:
Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).
Resumo:
69
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Bologna-type sausages were produced with 50% of their pork back-fat content replaced with gels elaborated with different ratios of pork skin, water, and amorphous cellulose (1:1:0, 1:1:0.1, 1:1:0.2, 1:1:0.3, and 1:1:0.4). The impact of such replacement on the physico-chemical characteristics and the consumer sensory profiling was evaluated. The modified treatments had 42% less fat, 18% more protein, and 8% more moisture than the control group. Treatments with amorphous cellulose had a lower cooking loss and higher emulsion stability. High amorphous cellulose content (1:1:0.3 and 1:1:0.4) increased hardness, gumminess, and chewiness. The gel formulated with the ratio of 1:1:0.2 (pork skin: water: amorphous cellulose gel) provided a sensory sensation similar to that provided by fat and allowed products of good acceptance to be obtained. Therefore, a combination of pork skin and amorphous cellulose is useful in improving technological quality and producing healthier and sensory acceptable bologna-type sausages.
Resumo:
Solar radiation, especially ultraviolet A (UVA) and ultraviolet B (UVB), can cause damage to the human body, and exposure to the radiation may vary according to the geographical location, time of year and other factors. The effects of UVA and UVB radiation on organisms range from erythema formation, through tanning and reduced synthesis of macromolecules such as collagen and elastin, to carcinogenic DNA mutations. Some studies suggest that, in addition to the radiation emitted by the sun, artificial sources of radiation, such as commercial lamps, can also generate small amounts of UVA and UVB radiation. Depending on the source intensity and on the distance from the source, this radiation can be harmful to photosensitive individuals. In healthy subjects, the evidence on the danger of this radiation is still far from conclusive.
Resumo:
175
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.