Analysis of perinatal gene expression: hormone response elements mediate activation of a lacZ reporter gene in liver of transgenic mice.

The transcription of genes encoding gluconeogenic enzymes is tightly regulated during the perinatal period. These genes are induced by glucagon (cAMP) and glucocorticoids and repressed by insulin. To address the role of cAMP and glucocorticoids in the physiological activation of genes encoding gluconeogenic enzymes in the perinatal period, transgenic mice have been generated with chimeric constructs containing the reporter gene lacZ under the control of hormone response elements. The activity of the transgene is restricted to the liver by the presence of the enhancers from the alpha-fetoprotein gene and its transcription is driven by a promoter that contains a TATA box linked to either cAMP response elements (CREs) or glucocorticoid response elements (GREs). We demonstrate cAMP and glucocorticoid regulation, liver-specific expression, and perinatal activation of the reporter gene. These data indicate that the CRE and GRE are, independently, necessary and sufficient to mediate perinatal gene activation. Perinatal activation was not impaired when a CRE reporter transgene was assayed in mice that contain a targeted mutation of the CRE-binding protein (CREB) gene, providing further evidence for functional redundancy among the members of the CREB/ATF gene family.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Next-generation sequencing of iron-metabolism related genes in Portuguese patients with iron overload: novel pathogenic genetic variants

Objective: In Southern European countries up to one-third of the patients with hereditary hemochromatosis (HH) do not present the common HFE risk genotype. In order to investigate the molecular basis of these cases we have designed a gene panel for rapid and simultaneous analysis of 6 HH-related genes (HFE, TFR2, HJV, HAMP, SLC40A1 and FTL) by next-generation sequencing (NGS). Materials and Methods: Eighty-eight iron overload Portuguese patients, negative for the common HFE mutations, were analysed. A TruSeq Custom Amplicon kit (TSCA, by Illumina) was designed in order to generate 97 amplicons covering exons, intron/exon junctions and UTRs of the mentioned genes with a cumulative target sequence of 12115bp. Amplicons were sequenced in the MiSeq instrument (IIlumina) using 250bp paired-end reads. Sequences were aligned against human genome reference hg19 using alignment and variant caller algorithms in the MiSeq reporter software. Novel variants were validated by Sanger sequencing and their pathogenic significance were assessed by in silico studies. Results: We found a total of 55 different genetic variants. These include novel pathogenic missense and splicing variants (in HFE and TFR2), a very rare variant in IRE of FTL, a variant that originates a novel translation initiation codon in the HAMP gene, among others. Conclusion: The merging of TSCA methodology and NGS technology appears to be an appropriate tool for simultaneous and fast analysis of HH-related genes in a large number of samples. However, establishing the clinical relevance of NGS-detected variants for HH development remains a hard-working task, requiring further functional studies.

Expression profiling of purified mouse gonadal somatic cells during the critical time window of sex determination reveals novel candidate genes for human sexual dysgenesis syndromes

Despite the identification of SRY as the testis-determining gene in mammals, the genetic interactions controlling the earliest steps of male sex determination remain poorly understood. In particular, the molecular lesions underlying a high proportion of human XY gonadal dysgenesis, XX maleness and XX true hermaphroditism remain undiscovered. A number of screens have identified candidate genes whose expression is modulated during testis or ovary differentiation in mice, but these screens have used whole gonads, consisting of multiple cell types, or stages of gonadal development well beyond the time of sex determination. We describe here a novel reporter mouse line that expresses enhanced green fluorescent protein under the control of an Sf1 promoter fragment, marking Sertoli and granulosa cell precursors during the critical period of sex determination. These cells were purified from gonads of male and female transgenic embryos at 10.5 dpc (shortly after Sry transcription is activated) and 11.5 dpc (when Sox9 transcription begins), and their transcriptomes analysed using Affymetrix genome arrays. We identified 266 genes, including Dhh, Fgf9 and Ptgds, that were upregulated and 50 genes that were downregulated in 11.5 dpc male somatic gonad cells only, and 242 genes, including Fst, that were upregulated in 11.5 dpc female somatic gonad cells only. The majority of these genes are novel genes that lack identifiable homology, and several human orthologues were found to map to chromosomal loci implicated in disorders of sexual development. These genes represent an important resource with which to piece together the earliest steps of sex determination and gonad development, and provide new candidates for mutation searching in human sexual dysgenesis syndromes.

Identification of Genes Modulating Mitochondrial Biogenesis in Caenorhabditis elegans

Since Altmann recognized ubiquitously distributed "bioblasts" in 1890, understanding of mitochondria has evolved from "elementary organisms" living inside cells and carrying out vital functions, over the Harman's "free radical theory" in 1956, to one of the driving forces of aging and cause of multiple associated diseases impacting society today. While a tremendous amount of work has contributed to the understanding of mitochondrial biology in different model organisms, the precise molecular mechanisms of basic mitochondrial function have yet to be deciphered. By employing an RNA interference mediated screen in Caenorhabditis elegans, we identified two transcription factors: SPTF-3, a member of Sp1 family, and an uncharacterized, nematode specific W04D2.4. We propose that both proteins modulate expression of many genes with regard to mitochondrial function including mitochondrial single-stranded binding protein encoded by mtss-1, whose promoter was used as transcriptional reporter in the screen. Further, RNA sequencing data indicate that W04D2.4 indirectly regulates expression of mitochondrial DNA via control of genes functionally related to mitochondrial replication and translation machineries. We also demonstrate that from all interventions targeting cytosolic translation, MTSS-1 levels are elevated only upon knockdown of genes encoding cytosolic ribosomal proteins. Reduction of ribosomes leads to increased sptf-3 translation, most likely in an internal ribosome entry side (IRES) mediated manner, eventually inducing mtss-1 expression. Moreover, we identify a novel role for SPTF-3 in the regulation of mitochondrial unfolded stress response (UPRmt) activation, but not endoplasmatic reticulum or oxidative stress responses. Taken together, this study identifies two transcription factors previously not associated with mitochondrial biogenesis and UPRmt in C. elegans, establishing a basis for further investigation of mito-nuclear interactions.

Membrane associated transporter protein gene (SLC45A2) and the genetic basis of normal human pigmentation variation

This work is concerned with the genetic basis of normal human pigmentation variation. Specifically, the role of polymorphisms within the solute carrier family 45 member 2 (SLC45A2 or membrane associated transporter protein; MATP) gene were investigated with respect to variation in hair, skin and eye colour ― both between and within populations. SLC45A2 is an important regulator of melanin production and mutations in the gene underly the most recently identified form of oculocutaneous albinism. There is evidence to suggest that non-synonymous polymorphisms in SLC45A2 are associated with normal pigmentation variation between populations. Therefore, the underlying hypothesis of this thesis is that polymorphisms in SLC45A2 will alter the function or regulation of the protein, thereby altering the important role it plays in melanogenesis and providing a mechanism for normal pigmentation variation. In order to investigate the role that SLC45A2 polymorphisms play in human pigmentation variation, a DNA database was established which collected pigmentation phenotypic information and blood samples of more than 700 individuals. This database was used as the foundation for two association studies outlined in this thesis, the first of which involved genotyping two previously-described non-synonymous polymorphisms, p.Glu272Lys and p.Phe374Leu, in four different population groups. For both polymorphisms, allele frequencies were significantly different between population groups and the 272Lys and 374Leu alleles were strongly associated with black hair, brown eyes and olive skin colour in Caucasians. This was the first report to show that SLC45A2 polymorphisms were associated with normal human intra-population pigmentation variation. The second association study involved genotyping several SLC45A2 promoter polymorphisms to determine if they also played a role in pigmentation variation. Firstly, the transcription start site (TSS), and hence putative proximal promoter region, was identified using 5' RNA ligase mediated rapid amplification of cDNA ends (RLM-RACE). Two alternate TSSs were identified and the putative promoter region was screened for novel polymorphisms using denaturing high performance liquid chromatography (dHPLC). A novel duplication (c.–1176_–1174dupAAT) was identified along with other previously described single nucleotide polymorphisms (c.–1721C>G and c.–1169G>A). Strong linkage disequilibrium ensured that all three polymorphisms were associated with skin colour such that the –1721G, +dup and –1169A alleles were associated with olive skin in Caucasians. No linkage disequilibrium was observed between the promoter and coding region polymorphisms, suggesting independent effects. The association analyses were complemented with functional data, showing that the –1721G, +dup and –1169A alleles significantly decreased SLC45A2 transcriptional activity. Based on in silico bioinformatic analysis that showed these alleles remove a microphthalmia-associated transcription factor (MITF) binding site, and that MITF is a known regulator of SLC45A2 (Baxter and Pavan, 2002; Du and Fisher, 2002), it was postulated that SLC45A2 promoter polymorphisms could contribute to the regulation of pigmentation by altering MITF binding affinity. Further characterisation of the SLC45A2 promoter was carried out using luciferase reporter assays to determine the transcriptional activity of different regions of the promoter. Five constructs were designed of increasing length and their promoter activity evaluated. Constitutive promoter activity was observed within the first ~200 bp and promoter activity increased as the construct size increased. The functional impact of the –1721G, +dup and –1169A alleles, which removed a MITF consensus binding site, were assessed using electrophoretic mobility shift assays (EMSA) and expression analysis of genotyped melanoblast and melanocyte cell lines. EMSA results confirmed that the promoter polymorphisms affected DNA-protein binding. Interestingly, however, the protein/s involved were not MITF, or at least MITF was not the protein directly binding to the DNA. In an effort to more thoroughly characterise the functional consequences of SLC45A2 promoter polymorphisms, the mRNA expression levels of SLC45A2 and MITF were determined in melanocyte/melanoblast cell lines. Based on SLC45A2’s role in processing and trafficking TYRP1 from the trans-Golgi network to stage 2 melanosmes, the mRNA expression of TYRP1 was also investigated. Expression results suggested a coordinated expression of pigmentation genes. This thesis has substantially contributed to the field of pigmentation by showing that SLC45A2 polymorphisms not only show allele frequency differences between population groups, but also contribute to normal pigmentation variation within a Caucasian population. In addition, promoter polymorphisms have been shown to have functional consequences for SLC45A2 transcription and the expression of other pigmentation genes. Combined, the data presented in this work supports the notion that SLC45A2 is an important contributor to normal pigmentation variation and should be the target of further research to elucidate its role in determining pigmentation phenotypes. Understanding SLC45A2’s function may lead to the development of therapeutic interventions for oculocutaneous albinism and other disorders of pigmentation. It may also help in our understanding of skin cancer susceptibility and evolutionary adaptation to different UV environments, and contribute to the forensic application of pigmentation phenotype prediction.

Error, Bias, and Long-Branch Attraction in Data for Two Chloroplast Photosystem Genes in Seed Plants

Sequences of two chloroplast photosystem genes, psaA and psbB, together comprising about 3,500 bp, were obtained for all five major groups of extant seed plants and several outgroups among other vascular plants. Strongly supported, but significantly conflicting, phylogenetic signals were obtained in parsimony analyses from partitions of the data into first and second codon positions versus third positions. In the former, both genes agreed on a monophyletic gymnosperms, with Gnetales closely related to certain conifers. In the latter, Gnetales are inferred to be the sister group of all other seed plants, with gymnosperms paraphyletic. None of the data supported the modern ‘‘anthophyte hypothesis,’’ which places Gnetales as the sister group of flowering plants. A series of simulation studies were undertaken to examine the error rate for parsimony inference. Three kinds of errors were examined: random error, systematic bias (both properties of finite data sets), and statistical inconsistency owing to long-branch attraction (an asymptotic property). Parsimony reconstructions were extremely biased for third-position data for psbB. Regardless of the true underlying tree, a tree in which Gnetales are sister to all other seed plants was likely to be reconstructed for these data. None of the combinations of genes or partitions permits the anthophyte tree to be reconstructed with high probability. Simulations of progressively larger data sets indicate the existence of long-branch attraction (statistical inconsistency) for third-position psbB data if either the anthophyte tree or the gymnosperm tree is correct. This is also true for the anthophyte tree using either psaA third positions or psbB first and second positions. A factor contributing to bias and inconsistency is extremely short branches at the base of the seed plant radiation, coupled with extremely high rates in Gnetales and nonseed plant outgroups. M. J. Sanderson,* M. F. Wojciechowski,*† J.-M. Hu,* T. Sher Khan,* and S. G. Brady

Enhanced human bone marrow stromal cell affinity for modified poly(L-lactide) surfaces by the upregulation of adhesion molecular genes

To enhance and regulate cell affinity for poly (l-lactic acid) (PLLA) based materials, two hydrophilic ligands, poly (ethylene glycol) (PEG) and poly (l-lysine) (PLL), were used to develop triblock copolymers: methoxy-terminated poly (ethylene glycol)-block-poly (l-lactide)-block-poly (l-lysine) (MPEG-b-PLLA-b-PLL) in order to regulate protein absorption and cell adhesion. Bone marrow stromal cells (BMSCs) were cultured on different composition of MPEG-b-PLLA-b-PLL copolymer films to determine the effect of modified polymer surfaces on BMSC attachment. To understand the molecular mechanism governing the initial cell adhesion on difference polymer surfaces, the mRNA expression of 84 human extracellular matrix (ECM) and adhesion molecules was analysed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). It was found that down regulation of adhesion molecules was responsible for the impaired BMSC attachment on PLLA surface. MPEG-b-PLLA-b-PLL copolymer films improved significantly the cell adhesion and cytoskeleton expression by upregulation of relevant molecule genes significantly. Six adhesion genes (CDH1, ITGL, NCAM1, SGCE, COL16A1, and LAMA3) were most significantly influenced by the modified PLLA surfaces. In summary, polymer surfaces altered adhesion molecule gene expression of BMSCs, which consequently regulated cell initial attachment on modified PLLA surfaces.

A re-examination of the Ghrelin and Ghrelin receptor genes

The last few years have seen dramatic advances in genomics, including the discovery of a large number of non-coding and antisense transcripts. This has revolutionised our understanding of multifaceted transcript structures found within gene loci and their roles in the regulation of development, neurogenesis and other complex processes. The recent and continuing surge of knowledge has prompted researchers to reassess and further dissect gene loci. The ghrelin gene (GHRL) gives rise to preproghrelin, which in turn produces ghrelin, a 28 amino acid peptide hormone that acts via the ghrelin receptor (growth hormone secretagogue receptor/GHSR 1a). Ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH) release, appetite regulation, and cancer development. A truncated receptor splice variant, GHSR 1b, does not bind ghrelin, but dimerises with GHSR 1a, and may act as a dominant negative receptor. The gene products of ghrelin and its receptor are frequently overexpressed in human cancer While it is well known that the ghrelin axis (ghrelin and its receptor) plays a range of important functional roles, little is known about the molecular structure and regulation of the ghrelin gene (GHRL) and ghrelin receptor gene (GHSR). This thesis reports the re-annotation of the ghrelin gene, discovery of alternative 5’ exons and transcription start sites, as well as the description of a number of novel splice variants, including isoforms with a putative signal peptide. We also describe the discovery and characterisation of a ghrelin antisense gene (GHRLOS), and the discovery and expression of a ghrelin receptor (growth hormone secretagogue receptor/GHSR) antisense gene (GHSR-OS). We have identified numerous ghrelin-derived transcripts, including variants with extended 5' untranslated regions and putative secreted obestatin and C-ghrelin transcripts. These transcripts initiate from novel first exons, exon -1, exon 0 and a 5' extended 1, with multiple transcription start sites. We used comparative genomics to identify, and RT-PCR to experimentally verify, that the proximal exon 0 and 5' extended exon 1 are transcribed in the mouse ghrelin gene, which suggests the mouse and human proximal first exon architecture is conserved. We have identified numerous novel antisense transcripts in the ghrelin locus. A candidate non-coding endogenous natural antisense gene (GHRLOS) was cloned and demonstrates very low expression levels in the stomach and high levels in the thymus, testis and brain - all major tissues of non-coding RNA expression. Next, we examined if transcription occurs in the antisense orientation to the ghrelin receptor gene, GHSR. A novel gene (GHSR-OS) on the opposite strand of intron 1 of the GHSR gene was identified and characterised using strand-specific RT-PCR and rapid amplification of cDNA ends (RACE). GHSR-OS is differentially expressed and a candidate non-coding RNA gene. In summary, this study has characterised the ghrelin and ghrelin receptor loci and demonstrated natural antisense transcripts to ghrelin and its receptor. Our preliminary work shows that the ghrelin axis generates a broad and complex transcriptional repertoire. This study provides the basis for detailed functional studies of the the ghrelin and GHSR loci and future studies will be needed to further unravel the function, diagnostic and therapeutic potential of the ghrelin axis.

The manipulation of apoptosis-related genes to generate resistance to Fusarium wilt and water stress in banana

Bananas are susceptible to a diverse range of biotic and abiotic stresses, many of which cause serious production constraints worldwide. One of the most destructive banana diseases is Fusarium wilt caused by the soil-borne fungus, Fusarium oxysporum f. sp. cubense (Foc). No effective control strategy currently exists for this disease which threatens global banana production. Although disease resistance exists in some wild bananas, attempts to introduce resistance into commercially acceptable bananas by conventional breeding have been hampered by low fertility, long generation times and association of poor agronomical traits with resistance genes. With the advent of reliable banana transformation protocols, molecular breeding is now regarded as a viable alternative strategy to generate disease-resistant banana plants. Recently, a novel strategy involving the expression of anti-apoptosis genes in plants was shown to result in resistance against several necrotrophic fungi. Further, the transgenic plants showed increased resistance to a range of abiotic stresses. In this thesis, the use of anti-apoptosis genes to generate transgenic banana plants with resistance to Fusarium wilt was investigated. Since water stress is an important abiotic constraint to banana production, the resistance of the transgenic plants to water stress was also examined. Embryogenic cell suspensions (ECS) of two commercially important banana cultivars, Grand Naine (GN) and Lady Finger (LF), were transformed using Agrobacterium with the anti-apoptosis genes, Bcl-xL, Bcl-xL G138A, Ced-9 and Bcl- 2 3’ UTR. An interesting, and potentially important, outcome was that the use of anti-apoptosis genes resulted in up to a 50-fold increase in Agrobacterium-mediated transformation efficiency of both LF and GN cells over vector controls. Regenerated plants were subjected to a complete molecular characterisation in order to detect the presence of the transgene (PCR), transcript (RT-PCR) and gene product (Western blot) and to determine the gene copy number (Southern blot). A total of 36 independently-transformed GN lines (8 x Bcl-xL, 5 x Bcl-xL G138A, 15 x Ced-9 and 8 x Bcl-2 3’ UTR) and 41 independently-transformed LF lines (8 x Bcl-xL, 7 x BclxL G138A, 13 x Ced-9 and 13 x Bcl-2 3’ UTR) were identified. The 41 transgenic LF lines were multiplied and clones from each line were acclimatised and grown under glasshouse conditions for 8 weeks to allow monitoring for phenotypic abnormalities. Plants derived from 3 x Bcl-xL, 2 x Ced-9 and 5 x Bcl-2 3’ UTR lines displayed a variety of aberrant phenotypes. However, all but one of these abnormalities were off-types commonly observed in tissue-cultured, non-transgenic banana plants and were therefore unlikely to be transgene-related. Prior to determining the resistance of the transgenic plants to Foc race 1, the apoptotic effects of the fungus on both wild-type and Bcl-2 3’ UTR-transgenic LF banana cells were investigated using rapid in vitro root assays. The results from these assays showed that apoptotic-like cell death was elicited in wild-type banana root cells as early as 6 hours post-exposure to fungal spores. In contrast, these effects were attenuated in the root cells of Bcl-2 3’ UTR-transgenic lines that were exposed to fungal spores. Thirty eight of the 41 transgenic LF lines were subsequently assessed for resistance to Foc race 1 in small-plant glasshouse bioassays. To overcome inconsistencies in rating the internal (vascular discolouration) disease symptoms, a MatLab-based computer program was developed to accurately and reliably assess the level of vascular discolouration in banana corms. Of the transgenic LF banana lines challenged with Foc race 1, 2 x Bcl-xL, 3 x Ced-9, 2 x Bcl-2 3’ UTR and 1 x Bcl-xL G138A-transgenic line were found to show significantly less external and internal symptoms than wild-type LF banana plants used as susceptible controls at 12 weeks post-inoculation. Of these lines, Bcl-2 3’ UTR-transgenic line #6 appeared most resistant, displaying very mild symptoms similar to the wild-type Cavendish banana plants that were included as resistant controls. This line remained resistant for up to 23 weeks post-inoculation. Since anti-apoptosis genes have been shown to confer resistance to various abiotic stresses in other crops, the ability of these genes to confer resistance against water stress in banana was also investigated. Clonal plants derived from each of the 38 transgenic LF banana plants were subjected to water stress for a total of 32 days. Several different lines of transgenic plants transformed with either Bcl-xL, Bcl-xL G138A, Ced-9 or Bcl-2 3’ UTR showed a delay in visual water stress symptoms compared with the wild-type control plants. These plants all began producing new growth from the pseudostem following daily rewatering for one month. In an attempt to determine whether the protective effect of anti-apoptosis genes in transgenic banana plants was linked with reactive oxygen species (ROS)-associated programmed cell death (PCD), the effect of the chloroplast-targeting, ROS-inducing herbicide, Paraquat, on wild-type and transgenic LF was investigated. When leaf discs from wild-type LF banana plants were exposed to 10 ìM Paraquat, complete decolourisation occurred after 48 hours which was confirmed to be associated with cell death and ROS production by trypan blue and 3,3-diaminobenzidine (DAB) staining, respectively. When leaf discs from the transgenic lines were exposed to Paraquat, those derived from some lines showed a delay in decolourisation, suggesting only a weak protective effect from the transgenes. Finally, the protective effect of anti-apoptosis genes against juglone, a ROS-inducing phytotoxin produced by the causal agent of black Sigatoka, Mycosphaerella fijiensis, was investigated. When leaf discs from wild-type LF banana plants were exposed to 25 ppm juglone, complete decolourisation occurred after 48 hours which was again confirmed to be associated with cell death and ROS production by trypan blue and DAB staining, respectively. Further, TdT-mediated dUTP nick-end labelling (TUNEL) assays on these discs suggested that the cell death was apoptotic. When leaf discs from the transgenic lines were exposed to juglone, discs from some lines showed a clear delay in decolourisation, suggesting a protective effect. Whether these plants are resistant to black Sigatoka is unknown and will require future glasshouse and field trials. The work presented in this thesis provides the first report of the use of anti-apoptosis genes as a strategy to confer resistance to Fusarium wilt and water stress in a nongraminaceous monocot, banana. Such a strategy may be exploited to generate resistance to necrotrophic pathogens and abiotic stresses in other economically important crop plants.

Prevalence of Staphylococcus aureus strains in an Australian cohort, 1989-2003 : evidence for the low prevalence of the toxic shock toxin and Panton-Valentine leukocidin genes

The purpose of this paper is to determine the prevalence of the toxic shock toxin gene (tst) and to enumerate the circulating strains of methicillin-sensitive Staphylococcus aureus (MSSA) and methicillin-resistant S. aureus (MRSA) in Australian isolates collected over two decades. The aim was to subtype these strains using the binary genes pvl, cna, sdrE, pUB110 and pT181. Isolates were assayed using real-time polymerase chain reaction (PCR) for mecA, nuc, 16 S rRNA, eight single-nucleotide polymorphisms (SNPs) and for five binary genes. Two realtime PCR assays were developed for tst. The 90 MRSA isolates belonged to CC239 (39 in 1989, 38 in 1996 and ten in 2003), CC1 (two in 2003) and CC22 (one in 2003). The majority of the 210 MSSA isolates belonged to CC1 (26), CC5 (24) and CC78 (23). Only 18 isolates were tst-positive and only 15 were pvl-positive. Nine MSSA isolates belonged to five binary types of ST93, including two pvlpositive types. The proportion of tst-positive and pvl-positive isolates was low and no significant increase was demonstrated. Dominant MSSA clonal complexes were similar to those seen elsewhere, with the exception of CC78. CC239 MRSA (AUS-2/3) was the predominant MRSA but decreased significantly in prevalence, while CC22 (EMRSA-15) and CC1 (WA-1) emerged. Genetically diverse ST93 MSSA predated the emergence of ST93- MRSA (the Queensland clone).

Investigation of highly regulated promoters for the production of recombinant proteins in plants

Plants have been identified as promising expression systems for the commercial production of recombinant proteins. Plant-based protein production or “biofarming” offers a number of advantages over traditional expression systems in terms of scale of production, the capacity for post-translation processing, providing a product free of contaminants and cost effectiveness. A number of pharmaceutically important and commercially valuable proteins, such as antibodies, biopharmaceuticals and industrial enzymes are currently being produced in plant expression systems. However, several challenges still remain to improve recombinant protein yield with no ill effect on the host plant. The ability for transgenic plants to produce foreign proteins at commercially viable levels can be directly related to the level and cell specificity of the selected promoter driving the transgene. The accumulation of recombinant proteins may be controlled by a tissue-specific, developmentally-regulated or chemically-inducible promoter such that expression of recombinant proteins can be spatially- or temporally- controlled. The strict control of gene expression is particularly useful for proteins that are considered toxic and whose expression is likely to have a detrimental effect on plant growth. To date, the most commonly used promoter in plant biotechnology is the cauliflower mosaic virus (CaMV) 35S promoter which is used to drive strong, constitutive transgene expression in most organs of transgenic plants. Of particular interest to researchers in the Centre for Tropical Crops and Biocommodities at QUT are tissue-specific promoters for the accumulation of foreign proteins in the roots, seeds and fruit of various plant species, including tobacco, banana and sugarcane. Therefore this Masters project aimed to isolate and characterise root- and seed-specific promoters for the control of genes encoding recombinant proteins in plant-based expression systems. Additionally, the effects of matching cognate terminators with their respective gene promoters were assessed. The Arabidopsis root promoters ARSK1 and EIR1 were selected from the literature based on their reported limited root expression profiles. Both promoters were analysed using the PlantCARE database to identify putative motifs or cis-acting elements that may be associated with this activity. A number of motifs were identified in the ARSK1 promoter region including, WUN (wound-inducible), MBS (MYB binding site), Skn-1, and a RY core element (seed-specific) and in the EIR1 promoter region including, Skn-1 (seed-specific), Box-W1 (fungal elicitor), Aux-RR core (auxin response) and ABRE (ABA response). However, no previously reported root-specific cis-acting elements were observed in either promoter region. To confirm root specificity, both promoters, and truncated versions, were fused to the GUS reporter gene and the expression cassette introduced into Arabidopsis via Agrobacterium-mediated transformation. Despite the reported tissue-specific nature of these promoters, both upstream regulatory regions directed constitutive GUS expression in all transgenic plants. Further, similar levels of GUS expression from the ARSK1 promoter were directed by the control CaMV 35S promoter. The truncated version of the EIR1 promoter (1.2 Kb) showed some differences in the level of GUS expression compared to the 2.2 Kb promoter. Therefore, this suggests an enhancer element is contained in the 2.2 Kb upstream region that increases transgene expression. The Arabidopsis seed-specific genes ATS1 and ATS3 were selected from the literature based on their seed-specific expression profiles and gene expression confirmed in this study as seed-specific by RT-PCR analysis. The selected promoter regions were analysed using the PlantCARE database in order to identify any putative cis elements. The seed-specific motifs GCN4 and Skn-1 were identified in both promoter regions that are associated with elevated expression levels in the endosperm. Additionaly, the seed-specific RY element and the ABRE were located in the ATS1 promoter. Both promoters were fused to the GUS reporter gene and used to transform Arabidopsis plants. GUS expression from the putative promoters was consitutive in all transgenic Arabidopsis tissue tested. Importantly, the positive control FAE1 seed-specific promoter also directed constitutive GUS expression throughout transgenic Arabidopsis plants. The constitutive nature seen in all of the promoters used in this study was not anticipated. While variations in promoter activity can be caused by a number of influencing factors, the variation in promoter activity observed here would imply a major contributing factor common to all plant expression cassettes tested. All promoter constructs generated in this study were based on the binary vector pCAMBIA2300. This vector contains the plant selection gene (NPTII) under the transcriptional control of the duplicated CaMV 35S promoter. This CaMV 35S promoter contains two enhancer domains that confer strong, constitutive expression of the selection gene and is located immediately upstream of the promoter-GUS fusion. During the course of this project, Yoo et al. (2005) reported that transgene expression is significantly affected when the expression cassette is located on the same T-DNA as the 35S enhancer. It was concluded, the trans-acting effects of the enhancer activate and control transgene expression causing irregular expression patterns. This phenomenon seems the most plausible reason for the constitutive expression profiles observed with the root- and seed-specific promoters assessed in this study. The expression from some promoters can be influenced by their cognate terminator sequences. Therefore, the Arabidopsis ARSK1, EIR1, ATS1 and ATS3 terminator sequences were isolated and incorporated into expression cassettes containing the GUS reporter gene under the control of their cognate promoters. Again, unrestricted GUS activity was displayed throughout transgenic plants transformed with these reporter gene fusions. As previously discussed constitutive GUS expression was most likely due to the trans-acting effect of the upstream CaMV 35S promoter in the selection cassette located on the same T-DNA. The results obtained in this study make it impossible to assess the influence matching terminators with their cognate promoters have on transgene expression profiles. The obvious future direction of research continuing from this study would be to transform pBIN-based promoter-GUS fusions (ie. constructs containing no CaMV 35S promoter driving the plant selection gene) into Arabidopsis in order to determine the true tissue specificity of these promoters and evaluate the effects of their cognate 3’ terminator sequences. Further, promoter truncations based around the cis-elements identified here may assist in determining whether these motifs are in fact involved in the overall activity of the promoter.