Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Exploitation of a pulsed neutron source for the structural study of anisotropic polymer films

A novel but simple time-of-flight neutron scattering geometry which allows structural anisotropy to be probed directly, simultaneously and thus unambiguously in polymeric and other materials is described. A particular advantage of the simultaneous data collection when coupled to the large area of the beam is that it enables thin films (< 10 μm < 10 mg) to be studied with relative ease. The utility of the technique is illustrated by studies on both deformed poly(styrene) glasses and on thin films of electrical conducting polymers. In the latter case, the power of isotopic substitution is illustrated to great effect. The development of these procedures for use in other areas of materials science is briefly discussed.

Internal nanoparticle structure of temperature-responsive self-assembled PNIPAM-b-PEG-b-PNIPAM triblock copolymers in aqueous solutions: NMR, SANS and light scattering studies

In this study we report detailed information on the internal structure of PNIPAM-b-PEG-b-PNIPAM nanoparticles formed from self-assembly in aqueous solutions upon increase in temperature. NMR spectroscopy, light scattering and small-angle neutron scattering (SANS) were used to monitor different stages of nanoparticle formation as a function of temperature, providing insight into the fundamental processes involved. The presence of PEG in a copolymer structure significantly affects the formation of nanoparticles, making their transition to occur over a broader temperature range. The crucial parameter that controls the transition is the ratio of PEG/PNIPAM. For pure PNIPAM, the transition is sharp; the higher the PEG/PNIPAM ratio results in a broader transition. This behavior is explained by different mechanisms of PNIPAM block incorporation during nanoparticle formation at different PEG/PNIPAM ratios. Contrast variation experiments using SANS show that the structure of nanoparticles above cloud point temperatures for PNIPAM-b-PEG-b-PNIPAM copolymers is drastically different from the structure of PNIPAM mesoglobules. In contrast with pure PNIPAM mesoglobules, where solid-like particles and chain network with a mesh size of 1-3 nm are present; nanoparticles formed from PNIPAM-b-PEG-b-PNIPAM copolymers have non-uniform structure with “frozen” areas interconnected by single chains in Gaussian conformation. SANS data with deuterated “invisible” PEG blocks imply that PEG is uniformly distributed inside of a nanoparticle. It is kinetically flexible PEG blocks which affect the nanoparticle formation by prevention of PNIPAM microphase separation.

A portable Compton spectrometer for clinical X-ray beams in the energy range 20-150 keV

Primary beam spectra were obtained for an X-ray industrial equipment (40-150 kV), and for a clinical mammography apparatus (25-35 kV) from beams scattered at angles close to 90 degrees, measured with a CdTe Compton spectrometer. Actual scattering angles were determined from the Compton energy shift of characteristic X-rays or spectra end-point energy. Evaluated contribution of coherent scattering amounts to more than 15% of fluence in mammographic beams. This technique can be used in clinical environments. (C) 2010 Elsevier Ltd. All rights reserved.

Self-assembling of phenothiazine compounds investigated by small-angle X-ray scattering and electron paramagnetic resonance spectroscopy

Small-angle X-ray scattering (SAXS) and electron paramagnetic resonance (EPR) have been carried out to investigate the structure of the self-aggregates of two phenothiazine drugs, chlorpromazine (CPZ) and trifluoperazine (TFP), in aqueous solution. In the SAXS studies, drug solutions of 20 and 60 mM, at pH 4.0 and 7.0, were investigated and the best data fittings were achieved assuming several different particle form factors with a homogeneous electron density distribution in respect to the water environment. Because of the limitation of scattering intensity in the q range above 0.15 angstrom(-1), precise determination of the aggregate shape was not possible and all of the tested models for ellipsoids, cylinders, or parallelepipeds fitted the experimental data equally well. The SAXS data allows inferring, however, that CPZ molecules might self-assemble in a basis set of an orthorhombic cell, remaining as nanocrystallites in solution. Such nanocrystals are composed of a small number of unit cells (up to 10, in c-direction), with CPZ aggregation numbers of 60-80. EPR spectra of 5- and 16-doxyl stearic acids bound to the aggregates were analyzed through simulation, and the dynamic and magnetic parameters were obtained. The phenothiazine concentration in EPR experiments was in the range of 5-60 mM. Critical aggregation concentration of TFP is lower than that for CPZ, consistent with a higher hydrophobicity of TFP. At acidic pH 4.0 a significant residual motion of the nitroxide relative to the aggregate is observed, and the EPR spectra and corresponding parameters are similar to those reported for aqueous surfactant micelles. However, at pH 6.5 a significant motional restriction is observed, and the nitroxide rotational correlation times correlate very well with those estimated for the whole aggregated particle from SAXS data. This implies that the aggregate is densely packed at this pH and that the nitroxide is tightly bound to it producing a strongly immobilized EPR spectrum. Besides that, at pH 6.5 the differences in motional restriction observed between 5- and 16-DSA are small, which is different from that observed for aqueous surfactant micelles.

Influence of the halo upon angular distributions for elastic scattering and breakup

The angular distributions for elastic scattering and breakup of halo nuclei are analysed using a near-side/far-side decomposition within the framework of the dynamical eikonal approximation. This analysis is performed for (11)Be impinging on Pb at 69 MeV/nucleon. These distributions exhibit very similar features. In particular they are both near-side dominated, as expected from Coulomb-dominated reactions. The general shape of these distributions is sensitive mostly to the projectile-target interactions, but is also affected by the extension of the halo. This suggests the elastic scattering not to be affected by a loss of flux towards the breakup channel. (C) 2010 Elsevier B.V. All rights reserved.

Scattering of neutral fermions by a pseudoscalar potential step in two-dimensional spacetime

The problem of scattering of neutral fermions in two-dimensional spacetime is approached with a pseudoscalar potential step in the Dirac equation. Some unexpected aspects of the solutions beyond the absence of Klein's paradox are presented. An apparent paradox concerning the uncertainty principle is solved by introducing the concept of effective Compton wavelength. Added plausibility for the existence of bound-state solutions in a pseudoscalar double-step potential found in a recent Letter is given. (C) 2003 Elsevier B.V. B.V. All rights reserved.

Structure of large two-neutron halos in light exotic nuclei

The structure of three-body halo nuclei formed by two neutrons and a core (nnc) is studied using zero-range interactions. The halo wave function can be completely parameterized only by the s-wave scattering lengths and two-neutron separation energy. The sizes and the neutron-neutron correlation function of Li-11 and Be-14 are calculated and compared to experimental data. A general classification scheme for three-body halos with two identical particles is discussed as well as the critical conditions to allow excited Efimov states.

Trajectory of neutron-neutron-C-18 excited three-body state

The trajectory of the first excited Efimov state is investigated by using a renormalized zero-range three-body model for a system with two bound and one virtual two-body subsystems. The approach is applied to n-n-C-18, where the n-n virtual energy and the three-body ground state are kept fixed. It is shown that such three-body excited state goes from a bound to a virtual state when the n-C-18 binding energy is increased. Results obtained for the n-C-19 elastic cross-section at low energies also show dominance of an S-matrix pole corresponding to a bound or virtual Efimov state. It is also presented a brief discussion of these findings in the context of ultracold atom physics with tunable scattering lengths. (C) 2008 Elsevier B.V. All rights reserved.

Light scattering on the structural characterization of DMPG vesicles along the bilayer anomalous phase transition

Highly charged vesicles of the saturated anionic lipid dimyristoyl phosphatidylglycerol (DMPG) in low ionic strength medium exhibit a very peculiar thermo-structural behavior. Along a wide gel-fluid transition region, DMPG dispersions display several anomalous characteristics, like low turbidity, high electrical conductivity and viscosity. Here, static and dynamic light scattering (SLS and DLS) were used to characterize DMPG vesicles at different temperatures. Similar experiments were performed with the largely studied zwitterionic lipid dimyristoyl phosphatidylcholine (DMPC). SLS and DLS data yielded similar dimensions for DMPC vesicles at all studied temperatures. However, for DMPG, along the gel-fluid transition region, SLS indicated a threefold increase in the vesicle radius of gyration, whereas the hydrodynamic radius, as obtained from DLS, increased 30% only. Despite the anomalous increase in the radius of gyration, DMPG lipid vesicles maintain isotropy, since no light depolarization was detected. Hence, SLS data are interpreted regarding the presence of isotropic vesicles within the DMPG anomalous transition, but highly perforated vesicles, with large holes. DLS/SLS discrepancy along the DMPG transition region is discussed in terms of the interpretation of the Einstein-Stokes relation for porous vesicles. Therefore, SLS data are shown to be much more appropriate for measuring porous vesicle dimensions than the vesicle diffusion coefficient. The underlying nanoscopic process which leads to the opening of pores in charged DMPG bilayer is very intriguing and deserves further investigation. One could envisage biotechnological applications, with vesicles being produced to enlarge and perforate in a chosen temperature and/or pH value. (C) 2012 Elsevier Ireland Ltd. All rights reserved.

Gaussian deconvolution: a useful method for a form-free modeling of scattering data from mono- and multilayered planar systems

A new method for analysis of scattering data from lamellar bilayer systems is presented. The method employs a form-free description of the cross-section structure of the bilayer and the fit is performed directly to the scattering data, introducing also a structure factor when required. The cross-section structure (electron density profile in the case of X-ray scattering) is described by a set of Gaussian functions and the technique is termed Gaussian deconvolution. The coefficients of the Gaussians are optimized using a constrained least-squares routine that induces smoothness of the electron density profile. The optimization is coupled with the point-of-inflection method for determining the optimal weight of the smoothness. With the new approach, it is possible to optimize simultaneously the form factor, structure factor and several other parameters in the model. The applicability of this method is demonstrated by using it in a study of a multilamellar system composed of lecithin bilayers, where the form factor and structure factor are obtained simultaneously, and the obtained results provided new insight into this very well known system.

Investigation of the nuclear matter density distributions of the exotic 12 Be, 14 Be and 8 B nuclei by elastic proton scattering in inverse kinematics

The proton-nucleus elastic scattering at intermediate energies is a well-established method for the investigation of the nuclear matter distribution in stable nuclei and was recently applied also for the investigation of radioactive nuclei using the method of inverse kinematics. In the current experiment, the differential cross sections for proton elastic scattering on the isotopes $^{7,9,10,11,12,14}$Be and $^8$B were measured. The experiment was performed using the fragment separator at GSI, Darmstadt to produce the radioactive beams. The main part of the experimental setup was the time projection ionization chamber IKAR which was simultaneously used as hydrogen target and a detector for the recoil protons. Auxiliary detectors for projectile tracking and isotope identification were also installed. As results from the experiment, the absolute differential cross sections d$sigma$/d$t$ as a function of the four momentum transfer $t$ were obtained. In this work the differential cross sections for elastic p-$^{12}$Be, p-$^{14}$Be and p-$^{8}$B scattering at low $t$ ($t leq$~0.05~(GeV/c)$^2$) are presented. The measured cross sections were analyzed within the Glauber multiple-scattering theory using different density parameterizations, and the nuclear matter density distributions and radii of the investigated isotopes were determined. The analysis of the differential cross section for the isotope $^{14}$Be shows that a good description of the experimental data is obtained when density distributions consisting of separate core and halo components are used. The determined {it rms} matter radius is $3.11 pm 0.04 pm 0.13$~fm. In the case of the $^{12}$Be nucleus the results showed an extended matter distribution as well. For this nucleus a matter radius of $2.82 pm 0.03 pm 0.12$~fm was determined. An interesting result is that the free $^{12}$Be nucleus behaves differently from the core of $^{14}$Be and is much more extended than it. The data were also compared with theoretical densities calculated within the FMD and the few-body models. In the case of $^{14}$Be, the calculated cross sections describe the experimental data well while, in the case of $^{12}$Be there are discrepancies in the region of high momentum transfer. Preliminary experimental results for the isotope $^8$B are also presented. An extended matter distribution was obtained (though much more compact as compared to the neutron halos). A proton halo structure was observed for the first time with the proton elastic scattering method. The deduced matter radius is $2.60pm 0.02pm 0.26$~fm. The data were compared with microscopic calculations in the frame of the FMD model and reasonable agreement was observed. The results obtained in the present analysis are in most cases consistent with the previous experimental studies of the same isotopes with different experimental methods (total interaction and reaction cross section measurements, momentum distribution measurements). For future investigation of the structure of exotic nuclei a universal detector system EXL is being developed. It will be installed at the NESR at the future FAIR facility where higher intensity beams of radioactive ions are expected. The usage of storage ring techniques provides high luminosity and low background experimental conditions. Results from the feasibility studies of the EXL detector setup, performed at the present ESR storage ring, are presented.

Concept and realization of the A4 compton backscattering polarimeter at MAMI

The main concern of the A4 parity violation experiment at the Mainzer Microtron accelerator facility is to study the electric and magnetic contributions of strange quarks to the charge and magnetism of the nucleons at the low momentum transfer region. More precisely, the A4 collaboration investigates the strange quarks' contribution to the electric and magnetic vector form factors of the nucleons. Thus, it is important that the A4 experiment uses an adequate and precise non-destructive online monitoring tool for the electron beam polarization when measuring single spin asymmetries in elastic scattering of polarized electrons from unpolarized nucleons. As a consequence, the A4 Compton backscattering polarimeter was designed and installed such that we can take the absolute measurement of the electron beam polarization without interruption to the parity violation experiment. The present study shows the development of an electron beam line that is called the chicane for the A4 Compton backscattering polarimeter. The chicane is an electron beam transport line and provides an interaction region where the electron beam and the laser beam overlap. After studying the properties of beam line components carefully, we developed an electron beam control system that makes a beam overlap between the electron beam and the laser beam. Using the system, we can easily achieve the beam overlap in a short time. The electron control system, of which the performance is outstanding, is being used in production beam times. And the study presents the development of a scintillating fiber electron detector that reduces the statistical error in the electron polarization measurement. We totally redesigned the scintillating fiber detector. The data that were taken during a 2008 beam time shows a huge background suppression, approximately 80 percent, while leaving the Compton spectra almost unchanged when a coincidence between the fiber detector and the photon detector is used. Thus, the statistical error of the polarization measurement is reduced by about 40 percent in the preliminary result. They are the significant progress in measuring a degree of polarization of the electron beam.

Bestimmung der Analysierstärke des A4-Compton-Rückstreupolarimeters zur Messung der longitudinalen Spinpolarisation des MAMI-Elektronenstrahls

Das A4-Experiment bestimmt den Beitrag der Strangequarks zu den elektromagnetischen Formfaktoren des Nukleons durch Messung der Paritätsverletzung in der elastischen Elektron-Nukleon-Streuung. Diese Messungen werden mit dem spinpolarisierten Elektronenstrahl des Mainzer Mikrotrons (MAMI) bei Strahlenergien zwischen 315 und 1508 MeV ndurchgeführt. Die Bestimmung des Strahlpolarisationsgrades ist für die Analyse der Daten unerläßlich, um die physikalische Asymmetrie aus der gemessenen paritätsverletzenden Asymmetrie extrahieren zu können. Aus diesem Grund wird von der A4-Kollaboration ein neuartiges Compton-Laserrückstreupolarimeter entwickelt, das eine zerstörungsfreie Messung der Strahlpolarisation, parallel zum laufenden Paritätsexperiment erlaubt. Um den zuverlässigen Dauerbetrieb des Polarimeters zu ermöglichen, wurde das Polarimeter im Rahmen dieser Arbeit weiterentwickelt. Das Datenerfassungssystem für Photonen- und Elektronendetektor wurde neu aufgebaut und im Hinblick auf die Verarbeitung hoher Raten optimiert. Zum Nachweis der rückgestreuten Photonen wurde ein neuartiger Detektor (LYSO) in Betrieb genommen. Darüber hinaus wurden GEANT4-Simulationen der Detektoren durchgeführt und eine Analyseumgebung für die Extraktion von Comptonasymmetrien aus den Rückstreudaten entwickelt. Das Analyseverfahren nutzt die Möglichkeit, die rückgestreuten Photonen durch koinzidente Detektion der gestreuten Elektronen energiemarkiert nachzuweisen (Tagging). Durch die von der Energiemarkierung eingeführte differentielle Energieskala wird somit eine präzise Bestimmung der Analysierstärke möglich. In der vorliegenden Arbeit wurde die Analysierstärke des Polarimeters bestimmt, so daß nun das Produkt von Elektronen- und Laserstrahlpolarisation bei einem Strahlstrom von 20 muA, parallel zum laufenden Paritätsexperiment, mit einer statistischen Genauigkeit von 1% in 24 Stunden bei 855 MeV bzw. <1% in 12 Stunden bei 1508 MeV gemessen werden kann. In Kombination mit der Bestimmung der Laserpolarisation in einer parallelen Arbeit (Y. Imai) auf 1% kann die statistische Unsicherheit der Strahlpolarisation im A4-Experiment von zuvor 5% auf nun 1,5% bei 1508MeV verringert werden. Für die Daten zur Messung der paritätsverletzenden Elektronenstreuung bei einem Viererimpulsübertrag von $Q^2=0,6 (GeV/c)^2$ beträgt die Rohasymmetrie beim derzeitigen Stand der Analyse $A_{PV}^{Roh} = ( -20,0 pm 0,9_{stat} ) cdot 10^{-6}$. Für eine Strahlpolarisation von 80% erhält man einen Gesamtfehler von $1,68 cdot 10^{-6}$ für $Delta P_e/P_e = 5 %$. Als Ergebnis dieser Arbeit wird sich dieser Fehler durch Analyse der Daten des Compton-Laserrückstreupolarimeters um 29% auf $1,19 cdot 10^{-6}$ ($Delta P_e/P_e = 1,5 %$) verringern lassen.