977 resultados para Motion Detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Simultaneous Localization and Mapping (SLAM) is a procedure used to determine the location of a mobile vehicle in an unknown environment, while constructing a map of the unknown environment at the same time. Mobile platforms, which make use of SLAM algorithms, have industrial applications in autonomous maintenance, such as the inspection of flaws and defects in oil pipelines and storage tanks. A typical SLAM consists of four main components, namely, experimental setup (data gathering), vehicle pose estimation, feature extraction, and filtering. Feature extraction is the process of realizing significant features from the unknown environment such as corners, edges, walls, and interior features. In this work, an original feature extraction algorithm specific to distance measurements obtained through SONAR sensor data is presented. This algorithm has been constructed by combining the SONAR Salient Feature Extraction Algorithm and the Triangulation Hough Based Fusion with point-in-polygon detection. The reconstructed maps obtained through simulations and experimental data with the fusion algorithm are compared to the maps obtained with existing feature extraction algorithms. Based on the results obtained, it is suggested that the proposed algorithm can be employed as an option for data obtained from SONAR sensors in environment, where other forms of sensing are not viable. The algorithm fusion for feature extraction requires the vehicle pose estimation as an input, which is obtained from a vehicle pose estimation model. For the vehicle pose estimation, the author uses sensor integration to estimate the pose of the mobile vehicle. Different combinations of these sensors are studied (e.g., encoder, gyroscope, or encoder and gyroscope). The different sensor fusion techniques for the pose estimation are experimentally studied and compared. The vehicle pose estimation model, which produces the least amount of error, is used to generate inputs for the feature extraction algorithm fusion. In the experimental studies, two different environmental configurations are used, one without interior features and another one with two interior features. Numerical and experimental findings are discussed. Finally, the SLAM algorithm is implemented along with the algorithms for feature extraction and vehicle pose estimation. Three different cases are experimentally studied, with the floor of the environment intentionally altered to induce slipping. Results obtained for implementations with and without SLAM are compared and discussed. The present work represents a step towards the realization of autonomous inspection platforms for performing concurrent localization and mapping in harsh environments.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Automatic analysis of human behaviour in large collections of videos is gaining interest, even more so with the advent of file sharing sites such as YouTube. However, challenges still exist owing to several factors such as inter- and intra-class variations, cluttered backgrounds, occlusion, camera motion, scale, view and illumination changes. This research focuses on modelling human behaviour for action recognition in videos. The developed techniques are validated on large scale benchmark datasets and applied on real-world scenarios such as soccer videos. Three major contributions are made. The first contribution is in the area of proper choice of a feature representation for videos. This involved a study of state-of-the-art techniques for action recognition, feature extraction processing and dimensional reduction techniques so as to yield the best performance with optimal computational requirements. Secondly, temporal modelling of human behaviour is performed. This involved frequency analysis and temporal integration of local information in the video frames to yield a temporal feature vector. Current practices mostly average the frame information over an entire video and neglect the temporal order. Lastly, the proposed framework is applied and further adapted to real-world scenario such as soccer videos. A dataset consisting of video sequences depicting events of players falling is created from actual match data to this end and used to experimentally evaluate the proposed framework.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Nowadays, the development of intelligent and autonomous vehicles used to perform agricultural activities is essential to improve quantity and quality of agricultural productions. Moreover, with automation techniques it is possible to reduce the usage of agrochemicals and minimize the pollution. The University of Bologna is developing an innovative system for orchard management called ORTO (Orchard Rapid Transportation System). This system involves an autonomous electric vehicle capable to perform agricultural activities inside an orchard structure. The vehicle is equipped with an implement capable to perform different tasks. The purpose of this thesis project is to control the vehicle and the implement to perform an inter-row grass mowing. This kind of task requires a synchronized motion between the traction motors and the implement motors. A motion control system has been developed to generate trajectories and manage their synchronization. Two main trajectories type have been used: a five order polynomial trajectory and a trapezoidal trajectory. These two kinds of trajectories have been chosen in order to perform a uniform grass mowing, paying a particular attention to the constrains of the system. To synchronize the motions, the electronic cams approach has been adopted. A master profile has been generated and all the trajectories have been linked to the master motion. Moreover, a safety system has been developed. The aim of this system is firstly to improve the safety during the motion, furthermore it allows to manage obstacle detection and avoidance. Using some particular techniques obstacles can be detected and recovery action can be performed to overcome the problem. Once the measured force reaches the predefined force threshold, then the vehicle stops immediately its motion. The whole project has been developed by employing Matlab and Simulink. Eventually, the software has been translated into C code and executed on the TI Lauchpad XL board.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acupuncture stimulates points on the body, influencing the perception of myofascial pain or altering physiologic functions. The aim was to evaluate the effect of electroacupuncture (EAC) and acupuncture (AC) for myofascial pain of the upper trapezius and cervical range of motion, using SHAM acupuncture as control. Sixty women presenting at least one trigger point at the upper trapezius and local or referred pain for more than six months were randomized into EAC, AC, and SHAM groups. Eight sessions were scheduled and a follow-up was conducted after 28 days. The Visual Analog Scale assessed the intensity of local and general pain. A fleximeter assessed cervical movements. Data were analyzed using paired t or Wilcoxon's tests, ANOVA or Friedman or Kruskal-Wallis tests and Pearson's correlation (α=0.05). There was reduction in general pain in the EAC and AC groups after eight sessions (P<0.001). A significant decrease in pain intensity occurred for the right trapezius in all groups and for the left trapezius in the EAC and AC groups. Intergroup comparisons showed improvement in general pain in the EAC and AC groups and in local pain intensity in the EAC group (P<0.05), which showed an increase in left rotation (P=0.049). The AC group showed increases in inclination (P=0.005) sustained until follow-up and rotation to the right (P=0.032). EAC and AC were effective in reducing the pain intensity compared with SHAM. EAC was better than AC for local pain relief. These treatments can assist in increasing cervical range of motion, albeit subtly.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.