995 resultados para MICROBIAL INFECTION
Resumo:
Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.
Resumo:
Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.
Resumo:
Urinary tract infection (UTI) is the most common infection posttransplant. However, the risk factors for and the impact of UTIs remain controversial. The aim of this study was to identify the incidence of posttransplant UTIs in a series of renal transplant recipients from deceased donors. Secondary objectives were to identify: (1) the most frequent infectious agents; (2) risk factors related to donor; (3) risk factors related to recipients; and (4) impact of UTI on graft function. This was a retrospective analysis of medical records from renal transplant patients from January to December 2010. Local ethics committee approved the protocol. The incidence of UTI in this series was 34.2%. Risk factors for UTI were older age, (independent of gender), biopsy-proven acute rejection episodes, and kidneys from deceased donors (United Network for Organ Sharing criteria). For female patients, the number of pretransplant pregnancies was an additional risk factor. Recurrent UTI was observed in 44% of patients from the UTI group. The most common infectious agents were Escherichia coli and Klebsiella pneumoniae, for both isolated and recurrent UTI. No difference in renal graft function or immunosuppressive therapy was observed between groups after the 1-year follow-up. In this series, older age, previous pregnancy, kidneys from expanded criteria donors, and biopsy-proven acute rejection episodes were risk factors for posttransplant UTI. Recurrence of UTI was observed in 44%, with no negative impact on graft function or survival.
Resumo:
By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.
Resumo:
To investigate endotoxin levels from primary endodontic infections before and after chemomechanical preparation (CMP) and to determine their antigenicity against 3T3 fibroblasts through gelatinolytic activity of matrix metalloproteinases (MMPs). Twenty-four root canals with primary endodontic infection and apical periodontitis were selected. Samples were collected using paper points before (S1) and after chemomechanical preparation (CMP) (S2). The limulus amebocyte lysate assay was used for endotoxin measurement. Fibroblasts were stimulated with root canal contents for 24 h. Supernatants of cell cultures stimulated with root canal contents were collected after 24 h to determine the levels of MMP-2 and MMP-9 gelatinolytic activity using the zymography technique. Friedman and Wilcoxon tests were used to compare the amount of endotoxin before (S1) and after CMP (S2) (P < 0.05). Data obtained from gelatinolytic activity were analysed using anova and Tukey's tests (P < 0.05). Endotoxin was recovered in 100% of the samples. There was a significant reduction in endotoxin levels after CMP (P < 0.05). A correlation was found between the levels of endotoxins and MMP-2 expression (P < 0.05). Root canal contents of initial samples (S1) induced significantly greater MMP-2 expression by fibroblasts when compared to S2 and the nonstimulated group (P < 0.05). No gelatinolytic activity of MMP-9 was observed in S1, S2 and control group. Root canal contents from primary endodontic infections had gelatinolytic activity for MMP-2. Moreover, CMP was effective in reducing endotoxin levels and their antigenicity against fibroblasts on gelatinolytic activity.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.
Resumo:
The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.
Resumo:
Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.
Resumo:
A wide variety of opportunistic pathogens has been detected in the tubing supplying water to odontological equipment, in special in the biofilm lining of these tubes. Among these pathogens, Pseudomonas aeruginosa, one of the leading causes of nosocomial infections, is frequently found in water lines supplying dental units. In the present work, 160 samples of water, and 200 fomite samples from forty dental units were collected in the city of Barretos, State of São Paulo, Brazil and evaluated between January and July, 2005. Seventy-six P. aeruginosa strains, isolated from the dental environment (5 strains) and water system (71 strains), were tested for susceptibility to six antimicrobial drugs most frequently used against P. aeruginosa infections. Susceptibility to ciprofloxacin, followed by meropenem was the predominant profile. The need for effective means of reducing the microbial burden within dental unit water lines is emphasized, and the risk of exposure and cross-infection in dental practice, in special when caused by opportunistic pathogens like P. aeruginosa, are highlighted.
Resumo:
This study describes vancomycin prescribing patterns in an average complexity hospital and compare the guidelines proposed by the Hospital Infection Control Practices Advisory Committee (HICPAC). The study was conducted in a 256-bed secondary-care hospital. Data were collected of all patients given vancomycin from March 2003 to February 2004, using a standardized chart-extraction form designed. Appropriate and inappropriate use was reviewed according to the Hospital Infection Control Practices Advisory Committee (HICPAC) guidelines on prudent vancomycin use. Out of 118 prescriptions, 95 (80.5%) were considered appropriate. Out of these 95 orders, 77 (81.1%) were administered for empiric treatment of suspected Gram-positive infections, 17 (17.9%) were administered for treatment of proven Gram-positive infections (76.5% identified as Staphyloccocus aureus-like agents) and 1 (1.0%) for beta-lactam allergy. The majority of the patients (96.6%) had recently used an antimicrobial medication (3 months). The mean pre-treatment hospitalization period was 11±10 days. Out of the 118 treatments, 67 (56.8%) were for nosocomial infections. The more frequent indications for vancomycin use were pneumonia (48.3%) and primary sepsis (18.6%), accounting for more than 66% of all treatments. No restriction policy was suggested because vancomycin use was considered adequate in the majority of the treatment cases. The broad empiric use of this antimicrobial was greater than expected in the institution and its use should be revised.