889 resultados para Human Symbolic Thinking and Acting


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The writings of John Dewey (1859-1952) and Simone Weil (1909-1943) were analyzed with a view to answering 3 main questions: What is wisdom? How is wisdom connected to experience? How does one educate for a love of wisdom? Using a dialectical method whereby Dewey (a pragmatist) was critiqued by Weil (a Christian Platonist) and vice versa, commonalities and differences were identified and clarified. For both, wisdom involved the application of thought to specific, concrete problems in order to secure a better way of life. For Weil, wisdom was centered on a love of truth that involved a certain way of applying one's attention to a concrete or theoretical problem. Weil believed that nature was subject to a divine wisdom and that a truly democratic society had supernatural roots. Dewey believed that any attempt to move beyond nature would stunt the growth of wisdom. For him, wisdom could be nourished only by natural streams-even if some ofthem were given a divine designation. For both, wisdom emerged through the discipline of work understood as intelligent activity, a coherent relationship between thinking and acting. Although Weil and Dewey differed on how they distinguished these 2 activities, they both advocated a type of education which involved practical experience and confronted concrete problems. Whereas Dewey viewed each problem optimistically with the hope of solving it, Weil saw wisdom in, contemplating insoluble contradictions. For both, educating for a love of wisdom meant cultivating a student's desire to keep thinking in line with acting-wanting to test ideas in action and striving to make sense of actions observed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The intent in this study was to investigate in what ways teachers· beliefs about education and teaching are expressed in the specific teaching behaviours they employ, and whether teaching behaviours, as perceived by their students, are correlated with students· critical thinking and self-directed learning. To this end the relationships studied were: among faCUlty members· philosophy of teaching, locus of control orientation, psychological type, and observed teaching behaviour; and among students· psychological type, perceptions of teaching behaviour, self-directed learning readiness, and critical thinking. The overall purpose of the study was to investigate whether the implicit goals of higher education, critical thinking and self-direction, were actually accounted for in the university classroom. The research was set within the context of path-goal theory, adapted from the leadership literature. Within this framework, Mezirow·s work on transformative learning, including the influences of Habermas· writings, was integrated to develop a theoretical perspective upon which to base the research methodology. Both qualitative and quantitative methodologies were incorporated. Four faCUlty and a total of 142 students participated in the study. Philosophy of teaching was described through faCUlty interviews and completion of a repertory grid. Faculty completed a descriptive locus of control scale, and a psychological type test. Observations of their teaching behaviour were conducted. Students completed a Teaching Behaviour Assessment Scale, the Self-Directed Learning Readiness Scale, a psychological type test, and the Watson-Glaser Critical Thinking Appraisal. A small sample of students were interviewed. Follow-up discussions with faculty were used to validate the interview, observation, teaching behaviour, and repertory grid data. Results indicated that some discrepancies existed between faculty's espoused philosophy of teaching and their observed teaching behaviour. Instructors' teaching behaviour, however, was a function of their personal theory of practice. Relationships were found between perceived teaching behaviour and students· self-directed learning and critical thinking, but these varied across situations, as would be predicted from path-goal theory. Psychological type of students and instructor also accounted for some of the variability in the relationships studied. Student psychological type could be shown as a partial predictor of self-directed learning readiness. The results were discussed in terms of theory development and implications for further research and practice.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Within sport, a tremendous amount of effort is committed to the on-the-field performance of athletes and coaches, neglecting the off-the-field performance and development of sport managers. This study examines the impact of human resource training on the performance of five Canadian national sport organizations (NSO) and their managers (N=22). Data were collected on three outcome variables (learning, individual performance, organizational performance) and three mediating variables (motivation to transfer, training design, organizational climate) at three time measures (pre-training, post-training1, post-training2). Results indicate that training improves the learning and individual performance of sport managers, as well as the organizational performance of NSOs. Varying relationships were found at each of the three time measures, demonstrating that a progression to training-related performance change exists, while providing support for three levels of analysis (individual, organizational, systemic). Implications and future research directions are discussed and highlight the need for on-going training opportunities for Canadian sport managers.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Genome sequence varies in numerous ways among individuals although the gross architecture is fixed for all humans. Retrotransposons create one of the most abundant structural variants in the human genome and are divided in many families, with certain members in some families, e.g., L1, Alu, SVA, and HERV-K, remaining active for transposition. Along with other types of genomic variants, retrotransponson-derived variants contribute to the whole spectrum of genome variants in humans. With the advancement of sequencing techniques, many human genomes are being sequenced at the individual level, fueling the comparative research on these variants among individuals. In this thesis, the evolution and functional impact of structural variations is examined primarily focusing on retrotransposons in the context of human evolution. The thesis comprises of three different studies on the topics that are presented in three data chapters. First, the recent evolution of all human specific AluYb members, representing the second most active subfamily of Alus, was tracked to identify their source/master copy using a novel approach. All human-specific AluYb elements from the reference genome were extracted, aligned with one another to construct clusters of similar copies and each cluster was analyzed to generate the evolutionary relationship between the members of the cluster. The approach resulted in identification of one major driver copy of all human specific Yb8 and the source copy of the Yb9 lineage. Three new subfamilies within the AluYb family – Yb8a1, Yb10 and Yb11 were also identified, with Yb11 being the youngest and most polymorphic. Second, an attempt to construct a relation between transposable elements (TEs) and tandem repeats (TRs) was made at a genome-wide scale for the first time. Upon sequence comparison, positional cross-checking and other relevant analyses, it was observed that over 20% of all TRs are derived from TEs. This result established the first connection between these two types of repetitive elements, and extends our appreciation for the impact of TEs on genomes. Furthermore, only 6% of these TE-derived TRs follow the already postulated initiation and expansion mechanisms, suggesting that the others are likely to follow a yet-unidentified mechanism. Third, by taking a combination of multiple computational approaches involving all types of genetic variations published so far including transposable elements, the first whole genome sequence of the most recent common ancestor of all modern human populations that diverged into different populations around 125,000-100,000 years ago was constructed. The study shows that the current reference genome sequence is 8.89 million base pairs larger than our common ancestor’s genome, contributed by a whole spectrum of genetic mechanisms. The use of this ancestral reference genome to facilitate the analysis of personal genomes was demonstrated using an example genome and more insightful recent evolutionary analyses involving the Neanderthal genome. The three data chapters presented in this thesis conclude that the tandem repeats and transposable elements are not two entirely distinctly isolated elements as over 20% TRs are actually derived from TEs. Certain subfamilies of TEs themselves are still evolving with the generation of newer subfamilies. The evolutionary analyses of all TEs along with other genomic variants helped to construct the genome sequence of the most recent common ancestor to all modern human populations which provides a better alternative to human reference genome and can be a useful resource for the study of personal genomics, population genetics, human and primate evolution.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cette thèse contribue à une théorie générale de la conception du projet. S’inscrivant dans une demande marquée par les enjeux du développement durable, l’objectif principal de cette recherche est la contribution d’un modèle théorique de la conception permettant de mieux situer l’utilisation des outils et des normes d’évaluation de la durabilité d’un projet. Les principes fondamentaux de ces instruments normatifs sont analysés selon quatre dimensions : ontologique, méthodologique, épistémologique et téléologique. Les indicateurs de certains effets contre-productifs reliés, en particulier, à la mise en compte de ces normes confirment la nécessité d’une théorie du jugement qualitatif. Notre hypothèse principale prend appui sur le cadre conceptuel offert par la notion de « principe de précaution » dont les premières formulations remontent du début des années 1970, et qui avaient précisément pour objectif de remédier aux défaillances des outils et méthodes d’évaluation scientifique traditionnelles. La thèse est divisée en cinq parties. Commençant par une revue historique des modèles classiques des théories de la conception (design thinking) elle se concentre sur l’évolution des modalités de prise en compte de la durabilité. Dans cette perspective, on constate que les théories de la « conception verte » (green design) datant du début des années 1960 ou encore, les théories de la « conception écologique » (ecological design) datant des années 1970 et 1980, ont finalement convergé avec les récentes théories de la «conception durable» (sustainable design) à partir du début des années 1990. Les différentes approches du « principe de précaution » sont ensuite examinées sous l’angle de la question de la durabilité du projet. Les standards d’évaluation des risques sont comparés aux approches utilisant le principe de précaution, révélant certaines limites lors de la conception d’un projet. Un premier modèle théorique de la conception intégrant les principales dimensions du principe de précaution est ainsi esquissé. Ce modèle propose une vision globale permettant de juger un projet intégrant des principes de développement durable et se présente comme une alternative aux approches traditionnelles d’évaluation des risques, à la fois déterministes et instrumentales. L’hypothèse du principe de précaution est dès lors proposée et examinée dans le contexte spécifique du projet architectural. Cette exploration débute par une présentation de la notion classique de «prudence» telle qu’elle fut historiquement utilisée pour guider le jugement architectural. Qu’en est-il par conséquent des défis présentés par le jugement des projets d’architecture dans la montée en puissance des méthodes d’évaluation standardisées (ex. Leadership Energy and Environmental Design; LEED) ? La thèse propose une réinterprétation de la théorie de la conception telle que proposée par Donald A. Schön comme une façon de prendre en compte les outils d’évaluation tels que LEED. Cet exercice révèle cependant un obstacle épistémologique qui devra être pris en compte dans une reformulation du modèle. En accord avec l’épistémologie constructiviste, un nouveau modèle théorique est alors confronté à l’étude et l’illustration de trois concours d'architecture canadienne contemporains ayant adopté la méthode d'évaluation de la durabilité normalisée par LEED. Une série préliminaire de «tensions» est identifiée dans le processus de la conception et du jugement des projets. Ces tensions sont ensuite catégorisées dans leurs homologues conceptuels, construits à l’intersection du principe de précaution et des théories de la conception. Ces tensions se divisent en quatre catégories : (1) conceptualisation - analogique/logique; (2) incertitude - épistémologique/méthodologique; (3) comparabilité - interprétation/analytique, et (4) proposition - universalité/ pertinence contextuelle. Ces tensions conceptuelles sont considérées comme autant de vecteurs entrant en corrélation avec le modèle théorique qu’elles contribuent à enrichir sans pour autant constituer des validations au sens positiviste du terme. Ces confrontations au réel permettent de mieux définir l’obstacle épistémologique identifié précédemment. Cette thèse met donc en évidence les impacts généralement sous-estimés, des normalisations environnementales sur le processus de conception et de jugement des projets. Elle prend pour exemple, de façon non restrictive, l’examen de concours d'architecture canadiens pour bâtiments publics. La conclusion souligne la nécessité d'une nouvelle forme de « prudence réflexive » ainsi qu’une utilisation plus critique des outils actuels d’évaluation de la durabilité. Elle appelle une instrumentalisation fondée sur l'intégration globale, plutôt que sur l'opposition des approches environnementales.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This thesis is an attempt to explore the problems faced by Indian Women and to examine the ways in which the human rights of women could be better protected in the light of international movements with special reference to national legislation and judicial decisions.The evolution of human rights from early period to Universal Declaration of Human Rights, 1948 is traced in the first chapter. The second chapter deals with the evolution of human rights in India. The evolution of fundamental rights and directive principles and the role played by the Indian Judiciary in enforcing the human rights enumerated in various international instruments dealing with human rights are also dealt with in this chapter. The rights guaranteed to women under the various international documents have been dealt with in the third chapter.It is noticed that the international documents have had their impact in India leading to creation of machinery for protection of human rights. Organised violations of women's rights such as prostitution, devadasi system, domestic violence, sexual harassment at workplaces, the evil of dowry, female infanticide etc. have been analysed in the light of existing laws and decisional jurisprudence in the fourth chapter. The fifth chapter analyses the decisions and consensus that emerged from the world conferences on women and their impact on the Indian Society and Judiciary. The constitutional provisions and legislative provisions protecting the rights of women have been critically examined in the sixth chapter. Chapter seven deals with various mechanisms evolved to protect the human rights of women. The eighth chapter contains conclusions and suggestions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this study the relationship between Innovative HR practices and selected HR outcomes is investigated.The current study represents a unique attempt to study the effects of innovative HR practices,with job satisfaction,organisational commitment and organisational citizenship bahaviour considered as the consequent variables.Results have affirmed the role of intervening variables such as job satisfaction and organisational commitment in establishing the link between IHRP and OCB obliterating any direct relation between IHRP and organisational citizenship behaviour.This finding may enable researchers in the human resource management to develop more robust understandings of the positive effects of innnovative HR practices on HR outcomes.Thus the present study provides the obvious contribution of weaving up yet another linkage between the two complimentary disciplines of Human Resource Management and Organisational Behaviour.The present study also contributes to the understanding of OCB by exploring its antecedents and extending the intervening role of job satisfaction and organisational commitment.The findings indicate that a higher level of introduction/initiation and satisfaction of innovative HR practices produces high job satisfaction and organisational commitment which lead to OCB.The researcher drew upon the perception-attitude-behaviour model to further realise the expected relationship among innovative HR practices,job satisfaction,organisational commitment and organisational citizenship behaviour.Consequently,this study makes a contribution to the broader organisational citizenship behaviour literature by manifesting the extended relationship path from innovative HR practices to organisational citizenship behaviour,and demonstrating that innovative Hr practices at the organisational level has an effect on employee attitudes and behaviours as well.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fertiliser value of human urine has been examined on several crops, yet little is known about its effects on key soil properties of agronomic significance. This study investigated temporal soil salinization potential of human urine fertiliser (HUF). It further looked at combined effects of human urine and wood ash (WA) on soil pH, urine-NH_3 volatilisation, soil electrical conductivity (EC), and basic cation contents of two Acrisols (Adenta and Toje series) from the coastal savannah zone of Ghana. The experiment was a factorial design conducted in the laboratory for 12 weeks. The results indicated an increase in soil pH by 1.2 units for Adenta series and 1 unit for Toje series after one week of HUF application followed by a decline by about 2 pH units for both soil types after twelve weeks. This was attributed to nitrification of ammonium to nitrate leading to acidification. The EC otherwise increased with HUF application creating slightly saline conditions in Toje series and non-saline conditions in Adenta series. When WA was applied with HUF, both soil pH and EC increased. In contrast, the HUF alone slightly salinized Toje series, but both soils remained non-saline whenWA and HUF were applied together. The application ofWA resulted in two-fold increase in Ca, Mg, K, and Na content compared to HUF alone. Hence, WA is a promising amendment of acid soils and could reduce the effect of soluble salts in human urine fertilizer, which is likely to cause soil salinity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

La globalización permeó las fronteras artificiales existentes entre la economía y la sociedad alrededor del mundo. Las actividades empresariales en este ambiente globalizado ha servido como catalizador de las violaciones de derechos humanos como consecuencia de la ausencia de la protección institucional algunas empresas han explotado los vacíos jurídicos y la falta de protección de los derechos humanos. Al respecto, para lograr un cambio paradigmático requiere un fuerte énfasis en los derechos y las obligaciones de las empresas. Este artículo presenta un análisis crítico de las obligaciones de las empresas en material de derechos humanos frente a la falta de cláusulas de estabilización en los contratos de inversión extranjera. En primer lugar, estas cláusulas son examinadas en relación con la responsabilidad en las obligaciones corporativas con relación a los derechos humanos fundamentales. De acuerdo con lo anterior, se analizan las dimensiones sustantivas y procesales de las cláusulas de estabilización. En segundo lugar, apelando a los ejemplos concretos del Acuerdo para el desarrollo de la Minería entre Mittal Steel y el Gobierno de Liberia, así como el proyecto del Oleoducto de Baku‐Tblisi‐Ceyhan como casos de análisis, este artículo busca la aplicación de las cláusulas de estabilidad en las inversiones extranjeras con relación a la protección de los derechos humanos por parte de los Estados y de las empresas. En tercer lugar, se propone una modificación a la forma como se introduce la cláusula relativa a los derechos humanos. En este orden de ideas, los derechos humanos de los inversionistas, específicamente de las empresas, deben ser incluidos en los acuerdos de inversión extranjera.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Lenguaje, pensamiento y filosofía son componentes fundamentales del aprendizaje de los niños. El manual comienza preguntando cómo puede el maestro proporcionar a los niños la oportunidad de desarrollar sus habilidades en estas áreas, por qué se deben enseñar y se examinan los enfoques actuales en este ámbito. Profundiza cómo los profesores pueden desarrollarlos en las seis áreas del aprendizaje para ayudar a los niños a adquirir y profundizar el entendimiento. Ofrece una introducción práctica a una serie de orientaciones para el aula.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Resumen tomado de la publicación