Eaux-fortes de Jules de Goncourt /

Etched title vignette.

Victor Cousin et son œuvre.

Reprinted in part from the Revue des deux mondes.

Victor Cousin.

Mode of access: Internet.

Collection des Goncourt. : Dessins, aquarelles et pastels du XVIIIe siècle /

"Dont la vente aura lieu Hôtel Drouot ... les ... 15 ... 16 ... 17 février, 1897"

The works of Charles Paul de Kock : with a general introduction by Jules Claretie.

Vols. 1-6 translated by Mary Hanford Ford; v. 7-21, 24-25, by Edith M. Norris; v. 22, by Arthur S. Martin; v. 23, by Arthur S. Martin and Edith M. Norris.

The works of Charles Paul de Kock, with a general introduction by Jules Claretie.

Vols. 1-6 translated by Mary Hanford Ford: v. 7-21, 24-25, by Edith M. Norris; v. 22, by Arthur S. Martin; v. 23, by Arthur S. Martin and Edith M. Norris.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Insetos em presépios e as "formigas vestidas" de Jules Martin (1832-1906): uma curiosa manufatura paulistana do final do século XIX

Encontrados no Brasil desde os primórdios da colonização portuguesa, os presépios logo tiveram de adaptar-se à realidade local, circunstância muito propícia ao aparecimento de concepções heterodoxas e ao emprego de elementos exóticos da fauna e flora de cada região. Como registros envolvendo insetos são muito pouco comuns, chama a atenção que fêmeas de saúva, Atta sp. (Hymenoptera, Formicidae), tenham sido aproveitadas na composição de presépios no estado de São Paulo. Tendo subsistido pelo menos até a década 1960, os "presépios de formigas" existentes em cidades como Embu das Artes poderiam estar relacionados às "formigas vestidas" criadas por Jules Martin, curiosa manufatura paulistana do último quartel do século XIX.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Monostephanostomum georgianum n. sp (Digenea : Acanthocolpidae) from Arripis georgianus (Valenciennes) (Perciformes : Arripidae) off Kangaroo Island, South Australia, with comments on Monostephanostomum Kruse, 1979 and Stephanostomum Looss, 1899

Monostephanostomum georgianum n. sp. is described from Arripis georgianus off Kangaroo Island, South Australia. It differs from its congeners by the presence of a short second row of oral spines. M. manteri Kruse, 1979 is reported from A. georgianus off southern Western Australia and Kangaroo Island, South Australia and A. trutta off northern Tasmania. It is considered that the other two species, M. yamagutii Ramadan, 1984 and M. krusei Reimer, 1983, should probably be removed from this genus. Two new combinations are formed, M. gazzae (Shen, 1990) n. comb. (from Stephanostomum) and M. mesospinosum (Madhavi, 1976) n. comb. (from Stephanostomum). A key to the four recognised species of Monostephanostomum is given.

A new subfamily, Bothriocrotoninae n. subfam., for the genus Bothriocroton Keirans, King & Sharrad, 1994 status amend. (Ixodida : Ixodidae), and the synonymy of Aponomma Neumann, 1899 with Amblyomma Koch, 1844

Evidence suggesting polyphyly of the traditionally recognised tick genus Aponomma Neumann, 1899 is summarized. Continued recognition of this genus in its current concept leaves a polyphyletic genus Aponomma and a paraphyletic genus Amblyomma Koch, 1844. To improve the correlation between our understanding of phylogenetic relationships in metastriate ticks and their classification, a few changes in classification are proposed. The members of the 'indigenous Australian Aponomma' group (sensu Kaufman, 1972), A. auruginans Schulze, 1936, A. concolor Neumann, 1899, A. glebopalma Keirans, King & Sharrad, 1994, A. hydrosauri (Denny, 1843) and A. undatum (Fabricius, 1775), are transferred to Bothriocroton Keirans, King & Sharrad, 1994, which is raised to full generic rank. The remaining members of Aponomma are transferred to Amblyomma. Uncertainty remains on relationships of Bothriocroton to other metastriate lineages and on the systematic position of the two species formerly included in the 'primitive Aponomma' group, A. elaphense Price, 1959 and A. sphenodonti Dumbleton, 1943.