Immunological mechanisms underlying infectious and chronic lung diseases

Le système respiratoire permet l'échange de gaz entre un organisme et son environnement. Pour fonctionner efficacement, il doit lutter contre les infections tout en maintenant une tolérance aux particules inoffensives. Les cytokines sont des petites protéines qui permettent la communication entre les différentes cellules et jouent un rôle important dans la régulation de l'homéostasie et de l'immunité des surfaces pulmonaires. Une production altérée des cytokines sous-tend beaucoup de maladies du système pulmonaire. Ainsi, la compréhension de la biologie fondamentale des cytokines pourrait contribuer à la mise au point de nouveaux traitements. Dans le cadre de cette thèse, nous avons étudié le rôle de deux cytokines, le TSLP (Thymic stromal lymphopoietin) et l'IL-17 (Interleukin 17) dans les réponses immunitaires bénéfiques et nuisibles en utilisant des modèles précliniques de souris des maladies pulmonaires. L'asthme est une maladie qui est caractérisée par la bronchoconstriction réversible, l'inflammation des voies respiratoires inférieures, l'hyperréactivité bronchique et le remodelage tissulaire. Le type d'inflammation affectant les voies respiratoires et la présence ou non d'allergie permettent d'établir les différents types d'asthme. La TSLP est une cytokine qui est principalement exprimée à des niveaux élevés dans les poumons de patients souffrant d'asthme allergique. En conséquence, la majeure partie de la recherche sur la TSLP a mis l'accent sur le rôle joué par celle- ci dans les réponses négatives conduisant au développement de l'asthme allergique. Dans cette thèse, nous montrons que la TSLP joue aussi un rôle bénéfique dans les réponses immunitaires pulmonaires. Nous avons découvert que la TSLP atténue la grippe en augmentant les réponses des lymphocytes T cytotoxiques contre le virus. Nous avons également étudié la fonction de la TSLP dans l'asthme non allergique. Contrairement à l'asthme allergique, nous avons constaté que la TSLP diminue les réponses inflammatoires dans l'asthme non allergique en réglant la production de l'IL-17, une cytokine qui favorise la maladie. Ainsi, nous démontrons les fonctions pleiotropes de la TSLP dans des contextes spécifiques de la maladie. Nos résultats ont des implications importantes pour le développement de thérapies ciblant la TSLP dans l'asthme. Dans la deuxième partie de la thèse, nous avons étudié les mécanismes pathogéniques qui sous-tendent le développement de la broncho-pneumopathie chronique obstructive (BPCO). La BPCO est une maladie chronique le plus largement associée aux fumeurs. Elle est caractérisée par une limitation progressive et irréversible du débit d'air et la destruction de la structure des poumons. L'augmentation globale de l'incidence de la maladie encourage grandement la compréhension des mécanismes pathogéniques et l'identification de nouvelles cibles thérapeutiques. Nous avons découvert que les micro-organismes trouvés dans les voies respiratoires aggravent la maladie en augmentant la production de l'IL-17. L'IL-17 est une cytokine inflammatoire qui est impliquée dans plusieurs maladies pulmonaires chroniques, dont la BPCO. Dans notre modèle animal de la maladie, nous avons neutralisé 1ÌL-17A en utilisant un anticorps spécifique et observé une reprise de la fonction pulmonaire. Dans cette étude, nous avons identifié 2 axes potentiels pour l'intervention thérapeutique contre la BPCO. Cibler les bactéries dans les voies respiratoires soit par l'utilisation d'antibiotiques ou l'utilisation de thérapies à base immunitaire qui antagonisent l'activité spécifiques de l'IL-17. Dans l'avenir, notre laboratoire va collaborer avec des cliniciens pour acquérir des échantillons humains et tester la pertinence de nos résultats dans la maladie humaine. -- L'interaction avec l'environnement extérieur est vitale pour le fonctionnement du système respiratoire. Par conséquent, ce dernier a adopté une multitude de réseaux effecteurs et régulateurs qui permettent de distinguer les particules inhalées comme «dangereuses» ou «inoffensives» et de réagir en conséquence. L'équilibre entre ces réseaux est essentielle pour lutter contre le «danger» déclenché par une infection ou des dommages, et finalement pour le retour à l'homéostasie. Le milieu de cytokine local contribue de manière significative à la mise au point de ces réponses. Ainsi, la caractérisation du rôle des cytokines dans l'état d'équilibre et la maladie a des implications claires pour les interventions thérapeutiques dans les maladies respiratoires aiguës et chroniques. Cette thèse a porté sur le rôle des cytokines, la lymphopoïétine stromale thymique (TSLP) et TIL-17A dans l'élaboration de réponses immunitaires pulmonaires. La TSLP est principalement produite par les cellules épithéliales et peut cibler une myriade de cellules immunitaires. Bien qu'elle ait été montrée être un puissant inducteur des réponses de type Th2, son rôle dans d'autres contextes inflammatoires est relativement inexploré. Dans le premier projet de cette thèse, nous avons découvert une nouvelle fonction de la TSLP dans l'immunité antivirale contre la grippe, une infection virale. Nous avons constaté que la TSLP a réglementé la réponse neutrophile au début de l'infection, en amplifiant l'immunité adaptative spécifique du virus. Mécaniquement, la TSLP a augmenté l'expression de l'IL-15 et du CD70 sur les cellules dendritiques recrutées dans les poumons suite à l'infection et a renforcé leur capacité de stimuler localement les lymphocytes T CD8+ spécifiques du virus. En outre, nous avons étudié la TSLP dans le cadre de divers phénotypes de l'asthme et également démontré l'impact pléiotropique qu'elle a sur les réponses immunitaires pulmonaires. En accord avec les rapports précédents, nous avons constaté que la TSLP a exacerbé l'inflammation atopique médiée par le Th2. En revanche la TSLP a réduit les réponses de l'IL-17A et l'inflammation neutrophile subséquente dans le modèle non atopique, ainsi que l'exacerbation du modèle atopique provoqué par une infection virale. Nos résultats démontrent une dichotomie dans le rôle de la TSLP dans la pathogenèse de l'asthme et soulignent la nécessité d'envisager plusieurs phénotypes d'asthme pour une évaluation approfondie de son potentiel thérapeutique dans cette maladie. Dans la seconde partie de cette thèse, nous avons caractérisé les mécanismes pathogènes qui sous-tendent la broncho-pneumopathie chronique obstructive (BPCO). La BPCO est une maladie hétérogène définie par une diminution progressive de la fonction pulmonaire. Bien que des déclencheurs environnementaux puissent aggraver la maladie, chez les personnes sensibles une maladie établie peut progresser à travers un cercle inflammatoire auto-entretenu. Nous avons cherché à définir les mécanismes sous-jacents à l'aide d'un modèle murin d'inflammation chronique, qui reproduit les caractéristiques pathologiques de la maladie humaine. Puisqu'ont été associés à la BPCO sévère des changements dans le microbiome des voies respiratoires, nous avons supposé que les signaux dérivés de certains microbes pourraient favoriser des voies inflammatoires chroniques de progression de la maladie. Nous avons observé que, en l'absence d un microbiome, la maladie s'est améliorée tel que démontré par une réduction de l'inflammation des voies respiratoires et une amélioration de la fonction pulmonaire. Cela a été lié spécifiquement à une production réduite d'IL-17A, une cytokine qui a été impliquée dans la maladie humaine. De plus la cinétique de production de 1IL- 17A dépendant du microbiote est corrélé à la sévérité de la maladie. Sur la base de ces données, la neutralisation de l'IL-17A a également eu un effet bénéfique sur l'évolution de la maladie. Le rôle significatif de 1TL-17A dans l'aggravation de la maladie a été couplé à sa capacité à engager un dialogue entre les voies inflammatoires innées et adaptatives. Il a influencé le recrutement et le phénotype des neutrophiles et des macrophages, ce qui a eu un impact direct et indirect sur la formation et la fonction des tissus lymphoïdes tertiaires associée à des stades sévères de la maladie. -- The interaction with the external environment is vital for the functioning of the respiratory system. Consequently, it has adopted a multitude of effector and regulatory networks that enable it to distinguish inhaled particles as 'dangerous' or 'innocuous' and respond accordingly. The balance between these networks is crucial to counteract the 'danger' triggered by infection or damage, and ultimately return to homeostasis. The local cytokine milieu contributes significantly to the fine- tuning of these responses. Thus, characterizing the role of cytokines in steady state and disease has clear implications for therapeutic interventions in acute and chronic respiratory disorders. This thesis focused on the role of the cytokines, thymic stromal lymphopoietin (TSLP) and IL-17A in shaping pulmonary immune responses. TSLP is primarily produced by barrier epithelial cells and can target a myriad of immune cells. Although it has been shown to be potent inducer of Th2 type responses, its role in other inflammatory settings is relatively unexplored. In the first project of this thesis, we discovered a novel function of TSLP in antiviral immunity to Influenza A infection. We found that while TSLP regulated the early neutrophilic response to infection, it amplified virus specific adaptive immunity. Mechanistically, TSLP enhanced the expression of IL-15 and CD70 on the lung recruited inflammatory dendritic cells and strengthened their ability to stimulate virus specific CD8+ T cell responses locally. In addition we investigated TSLP in the context of diverse asthma phenotypes and further demonstrated the pleiotropic impact it has on pulmonary immune responses. In concurrence with previous reports we found that TSLP exacerbated Th2 mediated atopic inflammation. In contrast TSLP curtailed IL-17A responses and subsequent neutrophilic inflammation in the non-atopic model as well as virus induced exacerbation of the atopic model. Our findings demonstrate a dichotomy in the role of TSLP in asthma pathogenesis and emphasize the need to consider multiple asthma phenotypes for a thorough evaluation of its therapeutic potential in this disease. In the next part of this thesis we characterized the pathogenic mechanisms underlying chronic obstructive pulmonary disease. COPD is a heterogeneous disease defined by a progressive decline in lung function. Although environmental triggers exacerbate the disease, in susceptible individuals the established disease can progress through a self-sustained inflammatory circle. We sought to delineate the underlying mechanisms by using a murine model of chronic inflammation, which reproduced key pathological features of the human disease. As changes in the airway microbiome have been linked to severe COPD, we speculated that microbial derived signals could facilitate the establishment of chronic inflammatory pathways that favour disease progression. We found that the absence of a microbiota ameliorated disease, exhibited by a reduction in airway inflammation and an improvement in lung function. This was linked specifically to an impaired production of IL-17A, a cytokine that has been implicated in human disease. Moreover the kinetics of microbiota-dependent IL-17A production correlated with the disease severity. Based on these data targeted neutralization of IL-17A also had a beneficiai effect on the disease outcome. The prominent role played by IL-I7A in driving the disease was coupled to its ability in engaging and mediating cross talk between pathogenic innate and adaptive immune pathways. It influenced the recruitment and phenotype of neutrophils and macrophages, as well as impacted upon the formation and function of tertiary lymphoid tissue associated with severe disease. Thus, temporal and spatial changes in cytokine production, their cellular targets and interaction with the local milieu determine the balance between immunity and pathology in the lung. Collectively our findings provide novel mechanistic insights in the complex role played by cytokines in orchestrating pulmonary immune responses and have clear implications for human disease.

Cerebriforms cells in cerebrum: an unusual finding

Background. Mycosis Fungoides (MF) is the most common cutaneous T-cell lymphoma, and large cell trasformation (tMF) is an adverse prognostic event. Extra-cutaneous dissemination can occur in the course of the disease, but dissemination to the central nervous system (CNS) is uncommon. Moreover, CNS lymphomas are overall rare and most often of B-cell phenotype. We report a case of CNS large T-cell lymphoma presenting as multiple cerebral lesions in a patient with a history of MF. Methods. We report a case of a 33-year-old woman, known since the age of 16 for erythematous plaques thought to be atopic dermatitis, who developed, end 2012, multiple nodular skin lesions and peripheral adenopathies. Two skin lesions were biopsied simultaneously, and diagnosed as MF and tMF. A lymph node biopsy showed dermatopathic changes without lymphoma (Stage IIB). She received local treatment (UVB, PUVA and radiation therapy) and interferon therapy, and experienced almost complete remission. In 2015 neurological symptoms lead to evidence multiple cerebral lesions, suspicious for lymphoma, evaluated by stereotaxic biopsies. We compared histopathological and molecular features of these with previous skin specimens. After negative bone marrow staging biopsy, she was recently started on chemotherapy (MATRIX). Short follow-up shows rapidly worsening clinical conditions. Results. One of the initial skin biopsies showed atypical lymphoid cells with epidermotropism, Pautrier abcesses and CD4+ CD30- phenotype; the other revealed diffuse dermal infiltration by predominantly large cerebriform tumor cells with high proliferative fraction, and CD2−CD3 −CD4+/−CD7−CD30+ALK- EMA- non-cytotoxic immunophenotype. Altogether, these results led us to diagnose MF and tMF, respectively. The brain was infiltrated by large atypical lymphoid cells with cerebriform nuclei, somewhat anaplastic features and perivascular distribution. By immunohistochemistry, tumor cells were highly proliferative, with a CD2−CD3+CD5−CD7+CD30+ activated cytotoxic immunophenotype. A diagnosis of CD30+ cytotoxic peripheral T-cell lymphoma was retained. TRG and TRB clonality analyses revealed clonal rearrangements in skin and CNS biopsies, with identical patterns in both skin specimens but only minimally overlapping profiles when compared to the CNS sample. Der Pathologe 6 ? 2015 | 633 Conclusions. The reported case illustrates an uncommon finding of a CNS T-cell lymphoma in a patient with previous MF, questioning the clonal relationship between the two diseases and challenging the adequate classification of this CNS lymphoma as either a progression or a de novo lymphoma. Despite differences in immunophenotype and clonality patterns, this CNS lymphoma could possibly represent an aggressive divergent evolution of a primary cutaneous T-cell lymphoma. Additional sequencing is ongoing to try to solve the question.

Avaluació dels nivells de nitrats i duresa a l'aigua de consum a quatre zones d'Espanya participants a l'estudi epidemiològic Infància i Medi Ambientl (INMA)

L’aigua és un dels components bàsics per a la vida i una font d’exposició a contaminants ubiqua, ja que tota la població en consumeix. L’estudi epidemiològic INMA avaluarà si l’exposició a nitrats durant l’embaràs i a la duresa de l’aigua durant la infància es relaciona amb el baix pes al néixer i l’èczema atòpica, respectivament. Objectiu: Fer una avaluació dels nivells de nitrats i duresa de l’aigua en aigua de consum de la població de l’estudi INMA. Metodologia: l’estudi descriptiu realitzat a quatre de les set cohorts INMA, a Astúries, Guipúscoa, Sabadell i València. S’ha recopilat dades dels nivells de nitrats i duresa a l’aigua de consum dels municipis durant el període d’interès (2003 al 2008 i 2004 al 2012), a través d’ajuntaments i companyies d’aigua. S’ha calculat la mitjana, la desviació estàndard, el màxim i el mínim dels nivells de nitrat i de duresa en total i segons l’àrea geogràfica, l’any i l’estació. A Sabadell s’han fet tres mostrejos d’aigua per analitzar la duresa a diferents punts de la ciutat. Resultats: el nivell promig de nitrats (mg/L NO3-) és de 4,2 a Astúries, 4,0 a Guipúscoa, 9,2 a Sabadell i 15,2 a València. El nivell promig de duresa (mg/L CaCO3) és de 89,1 a Astúries, 132,7 al Guipúscoa, 178,3 a València i 230,9 a Sabadell. En l’anàlisi que es va realitzar a Sabadell, es detecta una duresa lleugerament inferior a la reportada sense variabilitat geogràfica. No s’observa una pauta clara de variabilitat estacional ni de variabilitat temporal tant per nitrats com per duresa. Conclusions: S’ha detectat variabilitat en els nivells de nitrats i duresa de l’aigua a les zones d’estudi. Els nivells de nitrats són moderats i els més alts es troben a zones agrícoles de València. La duresa de l’aigua és força alta degut al domini calcari dels subsòls de les zones d’estudi.

Immunomodulation of allergic immune response during specific immunotherapy

Atopic, IgE-mediated allergies are one of the major public health problems in Finland and other Western countries. These diseases are characterized by type 2 T helper (Th2) cell predominated immune responses (interleukin-4 (IL-4), IL-5) against ubiquitous environmental allergens. Despite of adequate pharmacological treatment, more than 20% of the patients with allergic rhinitis develop asthma. Allergen specific immunotherapy (SIT) is the only treatment currently available to affect to the natural course of allergic diseases. This treatment involves repeated administration of allergens to the patients either via sublingual route (sublingual immunotherapy, SLIT) or by subcutaneous injections (subcutaneous immunotherapy, SCIT). Successful treatment with SCIT or SLIT has been shown to provide long-term remission in symptoms, and prevent disease progression to asthma, but the immunological mechanisms behind these beneficial effects are not yet completely understood. Increased knowledge of such mechanisms could not only help to improve SIT efficacy, but also provide tools to monitor the development of clinical response to SIT in individual patients, and possibly also, predict the ultimate therapeutic outcome. The aim of this work was to clarify the immunological mechanisms associated with SIT by investigating the specific allergen-induced immune responses in peripheral blood mononuclear cells (PBMC) of allergic rhinitis patients during the course of SLIT and SCIT. The results of this work demonstrate that both therapies induced increases in the protective, Th2-balancing Th1 type immune responses in PBMC, e.g. by up-regulating signaling lymphocytic activation molecule (SLAM) and interferon gamma (IFN-γ) expression, and augmented tolerogenic T regulatory (Treg) cell type responses against the specific allergens, e.g. by increasing IL-10 or Forkhead box P3 (FOXP3) expression. The induction of allergen-specific Th1 and Treg type responses during SLIT were dependent on the treatment dose, favoring high allergen dose SLIT. During SCIT, the early decrease in Th2 type cytokine production - in particular of IL-4 mRNA and IL-4/IFN-γ expression ratio - was associated with the development of good therapeutic outcome. Conversely, increases in both Th2 (IL-5) and Th1 (IFN-γ, SLAM) type responses and IL-10 mRNA production were seen in the patients with less effective outcome. In addition, increase in Th17 type cytokine (IL-17) mRNA production was found in the PBMC of patients with less effective outcome during both SLIT and SCIT. These data strengthen the current hypothesis that immunomodulation of allergen-specific immune responses from the prevailing Th2-biased responses towards a more Th1 type, and induction of tolerogenic Treg cells producing IL-10 represent the two key mechanisms behind the beneficial effects of SIT. The data also give novel insight into the mechanisms why SIT may fail to be effective in some patients by demonstrating a positive correlation between the proinflammatory IL-17 responses, Th2 type IL-5 production and clinical symptoms. Taken together, these data indicate that the analysis of Th1, Th2, Treg ja Th17-associated immune markers such as IL-10, SLAM, IL-4, IL-5 and IL-17 could provide tools to monitor the development of clinical response to SIT, and thereby, predict the ultimate clinical outcome already in the early course of the treatment.

Interactions between Polyunsaturated Fatty Acids and Probiotics

The prevalence of inflammatory based diseases has increased in industrialized countries over the last decades. For allergic diseases, two primary hypotheses have been proposed to explain this phenomenon, namely the hygiene and dietary evolution based hypothesis. Particularly, the reduced early exposure to microbes and an increase in the amount of polyunsaturated fatty acids (especially n-6 PUFA) in the diet have been discussed. Often, these two factors have been studied independently, even though both factors have been shown to possess potential health benefits and their mode of action to share similar mechanisms. The hypothesis of the present study was that demonstrate that PUFA and probiotics are not separate entities as such but do interact with each other. In the present study, we investigated whether maternal diet and atopic status influence the PUFA composition of breast milk and serum fatty acids of infants, and whether the fatty acid absorption and utilization of infant formula fatty acids is affected by supplementation of infant formula with probiotic bacteria (Lactobacillus GG and Bifidobacterium lactis Bb-12). Moreover, we investigated the mechanisms by which different PUFA influence the physicochemical and functional properties of probiotics as well as functionality of epithelial cells in vitro. We demonstrated a carry-over effect of dietary fatty acids from maternal diet via breast milk into infants’ serum lipid fatty acids. Our data confirmed the previously shown allergy –related PUFA level imbalances, though it did not fully support the impaired desaturation and elongation capacity hypothesis. We also showed that PUFA incorporation into phospholipids of infants was influenced by probiotics in infant formula in a strain dependent manner. Especially,Bifidobacterium lactis Bb-12 in infant formula promoted the utilization of n-3 PUFA. Mechanistically, we demonstrated that probiotics (Lactobacillus GG, Lactobacillus casei Shirota and Lactobacillus bulgaricus) did incorporate and interconvert exogenous free PUFA in the growth medium into bacterial fatty acids strain and PUFA dependently. In general, high concentrations of free PUFA inhibited the growth and mucus adhesion of probiotics, whereas low concentrations of specific long chain PUFA were found to promote the growth and mucus adhesion of Lactobacillus casei Shirota. These effects were paralleled with only minor alterations in hydrophobicity and electron donor – electron acceptor properties of lactobacilli. Furthermore, free PUFA were also demonstrated to alter the adhesion capacity of the intestinal epithelial cells; n-6 PUFA tended to inhibit the Caco-2 adhesion of probiotics, whereas n-3 PUFA had either no or minor effects or even promote the bacterial adhesion (especially Lactobacillus casei Shirota) to PUFA treated Caco-2 cells. The results of this study demonstrate the close and bilateral interactions between dietary PUFA and probiotics. Probiotics were shown to influence the absorption and utilization of dietary PUFA, whereas PUFA were shown to alter the functional properties of both probiotics and mucosal epithelia. These findings suggest that a more thorough understanding of interactions between PUFA and intestinal microbiota is a prerequisite, when the beneficial effects of new functional foods containing probiotics are designed and planned for human intervention studies.

An Infant with Food Allergy and Eczema in the Family – The Mental and Economic Burden of Caring

Allergic diseases including food allergy and eczema in an infant in combination with the everyday activities of caring for a family will pose challenges to parents. Only fragments of these challenges are revealed to health care professionals. Families have varying mental, social and economic resources to help them care for an allergic infant, and all such resources are important in determining how families succeed in meeting these challenges and the quality of the infant’s care. This study evaluated the whole burden to the family caused by an infant's allergic disease during the first 24 months of life. As the primary caregiver during this period is usually the mother, her perspective was considered important. Ecocultural theory, which considers families as capable of modifying the positive and negative forces facing them, was taken as the frame of reference. Data were collected as part of an ongoing prospective mother-infant study, and the methods included severity scoring of atopic dermatitis, dietary records, health-related quality of life measurements and assessments of the use of health care services and medications for treating the infant’s eczema, food allergy and asthma. Interviews with mothers were analysed by deductive content analysis on the basis of ecocultural theory and the family empowerment model. The theme “Living an ordinary family life” guided the organization of family activities essential for treating the infant's food allergy and eczema. These activities were sources of both strain and support for the mothers, the allergy-related supporting factors being the mother’s own knowledge of the allergy, hopes for an improvement in the infant’s condition, social support and work. An infant’s food allergy at the age of one year caused considerable strain for the mother in cases where the introduction of new foods into the child’s diet was delayed. This delay was still causing the mother additional strain when the child was 24 months of age. The infants waking at night at the ages of 12 and 24 months because of itching related to eczema caused strain for the mothers. The infants’ health-related quality of life was impaired at ages of 6 and 12 months compared with healthy infants. The principal reasons for impairments were itching, scratching and sleep disturbances at 6 and 12 months and treatment difficulties at 6 months. Problems with getting to sleep were reported at all stages irrespective of eczema and were also present in healthy infants. The economic impact of the treatment of allergic diseases on families during the first 24 months was 131 EUR (2006 value) in cases of eczema and 525 EUR in cases of food allergy. From the societal perspective, the costs of food allergy were a median of 3183 EUR (range 628–11 560 EUR) and of eczema a median of 275 EUR (range 94–1306 EUR). These large variations in costs in food allergy and eczema indicate that disease varies greatly . In conclusion, food allergy and eczema cause extra activities and costs to families which arrange these disease-related activities in such a way that they support the leading family theme “Living an ordinary family life”. Health care professionals should consider this thematic character of family life and disease-related activities in order to ensure that new treatments are sustainable, meaningful and tailored to daily activities. In addition, those mothers who are experiencing difficulties with food allergic infants or infants with eczema should be recognized early and provided with individual encouragement and support from health clinics. In the light of the present results, early detection of symptoms and effective parental guidance can contribute to the well-being and health-related quality of life of the child and family.

Evaluation of skin sensitivity in dogs bearing allergic dermatitis to standardized allergenic extract of house dust and storage mites

The objective of the study was to evaluate whether allergenic extracts of five house dust and storage mite species standardized for humans might be used for the diagnosis of canine atopic dermatitis (CAD). Extracts of Dermatophagoides pteronyssinus (Pyroglyphidae), D. farinae (Pyroglyphidae), Blomia tropicalis (Glycyphagidae), Lepidoglyphus destructor (Glycyphagidae) and Tyrophagus putrescentiae (Acaridae) were evaluated by intradermal testing in 20 healthy dogs (control) and 25 dogs with allergic dermatitis. A significant difference in the response was observed between the two groups (p<0.05). Only one dog (5%) in the control group reacted to the intradermal test, whereas 14 dogs (56%) in the allergic group were positive for at least one extract (odds ratio = 24.2). Most of the positive reactions observed in the allergic group occurred against the extracts of T. putrescentiae or L. destructor, each inducing reactions in 10 dogs (40%). D. farinae, D. pteronyssinus e B. tropicalis extracts induced reactions in 7 (28%), 3 (12%) and 3 (12%) dogs, respectively. The allergenic extracts standardized for humans evaluated in the present study may be used as a tool to complement the diagnosis of the disease, as well as to select potential allergen candidates for allergen-specific immunotherapy.

Pre- and postnatal nutrition – target for allergy risk reduction

A rapid increase in allergic diseases in Western societies has led to the conclusion that our modern lifestyle is a risk factor for immune dysregulation. Potential culprits and benefactors are searched among early dietary and microbial exposures, which may act to program later allergic disease. The aim of this thesis was to investigate the role of early maternal and child nutrition in reducing the risk of child allergy. The study population comprised of 256 mother – child pairs from families with a history of allergy participating in a randomized controlled dietary counseling and probiotic intervention (Lactobacillus rhamnosus GG and Bifidobacterium lactis Bb12) study from early pregnancy onwards. The dietary counseling aimed for a diet complying with dietary recommendations for pregnant and lactating women, with special attention to fat quality. Maternal dietary counseling was reflected in cord blood fatty acids suggesting better essential fatty acid status in infants in the counseling group. Dietary counseling with probiotics or placebo had no effect on child allergy risk, but associations between maternal diet during pregnancy and breastfeeding and child allergic outcomes were found in secondary analyses. During pregnancy, milk intake was related to decreased and cheese intake to increased risk of child atopic eczema. During breastfeeding, intake of vitamin C was related to increased risk of asthma and intake of egg was related to decreased risk of atopic eczema. The timing of introduction of complementary foods to infant’s diet was not associated with risk of atopic eczema, when adjusted with parental opinion of child allergic symptoms (i.e., potential reverse causality). In conclusion, the results demonstrate that infant fatty acid supply can be modified via maternal dietary changes. In addition, interesting associations of maternal diet with child allergy risk were discovered. However, no difference in the incidence of allergic diseases with dietary counseling was observed. This suggests that more potent dietary interventions might be necessitated to induce clinical risk reduction of allergy. Highrisk families can safely adhere to dietary recommendations for pregnant and lactating women, and the results support the current conception that no additional benefit is gained with delaying introduction of complementary feeding.

Immunoglobulin E and systemic lupus erythematosus

Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by intense polyclonal production of autoantibodies and circulating immune complexes. Some reports have associated SLE with a Th2 immune response and allergy. In the present study 21 female patients with SLE were investigated for total IgE and IgE antibodies to dust house aeroallergens by an automated enzyme-linked fluorescent assay, and were also evaluated for antinuclear IgE autoantibodies by a modified indirect immunofluorescence test using HEp-2 cells as antigen substrate. Additionally, immunocapture ELISA was used to investigate serum anti-IgE IgG autoantibodies. Serum IgE above 150 IU/ml, ranging from 152 to 609 IU/ml (median = 394 IU IgE/ml), was observed in 7 of 21 SLE patients (33%), 5 of them presenting proteinuria, urinary cellular casts and augmented production of anti-dsDNA antibodies. While only 2 of 21 SLE patients (9.5%) were positive for IgE antibodies to aeroallergens, all 10 patients with respiratory allergy (100%) from the atopic control group (3 males and 7 females), had these immunoglobulins. SLE patients and healthy controls presented similar anti-IgE IgG autoantibody titers (X = 0.37 ± 0.20 and 0.34 ± 0.18, respectively), differing from atopic controls (0.94 ± 0.26). Antinuclear IgE autoantibodies were detected in 17 of 21 (81%) sera from SLE patients, predominating the fine speckled pattern of fluorescence, that was also observed in IgG-ANA. Concluding, SLE patients can present increased IgE levels and antinuclear IgE autoantibodies without specific clinical signs of allergy or production of antiallergen IgE antibodies, excluding a possible association between SLE and allergy.

Superoxide release and cellular gluthatione peroxidase activity in leukocytes from children with persistent asthma

Asthma is an inflammatory condition characterized by the involvement of several mediators, including reactive oxygen species. The aim of the present study was to investigate the superoxide release and cellular glutathione peroxidase (cGPx) activity in peripheral blood granulocytes and monocytes from children and adolescents with atopic asthma. Forty-four patients were selected and classified as having intermittent or persistent asthma (mild, moderate or severe). The spontaneous or phorbol myristate acetate (PMA, 30 nM)-induced superoxide release by granulocytes and monocytes was determined at 0, 5, 15, and 25 min. cGPx activity was assayed spectrophotometrically. The spontaneous superoxide release by granulocytes from patients with mild (N = 15), moderate (N = 12) or severe (N = 6) asthma was higher at 25 min compared to healthy individuals (N = 28, P < 0.05, Duncan test). The PMA-induced superoxide release by granulocytes from patients with moderate (N = 12) or severe (N = 6) asthma was higher at 15 and 25 min compared to healthy individuals (N = 28, P < 0.05 in both times of incubation, Duncan test). The spontaneous or PMA-induced superoxide release by monocytes from asthmatic patients was similar to healthy individuals (P > 0.05 in all times of incubation, Duncan test). cGPx activity of granulocytes and monocytes from patients with persistent asthma (N = 20) was also similar to healthy individuals (N = 10, P > 0.05, Kruskal-Wallis test). We conclude that, under specific circumstances, granulocytes from children with persistent asthma present a higher respiratory burst activity compared to healthy individuals. These findings indicate a risk of oxidative stress, phagocyte auto-oxidation, and the subsequent release of intracellular toxic oxidants and enzymes, leading to additional inflammation and lung damage in asthmatic children.

Evidence for the participation of nitric oxide in pemphigus

Pemphigus is an inflammatory autoimmune disorder of the skin. Nitric oxide (NO) is an inflammatory mediator linked to a variety of physiological and pathophysiological phenomena that include skin tumors, psoriasis, urticaria, and atopic dermatitis. Inflammatory cells present in pemphigus lesions are important sources of NO production. We investigated whether NO is involved in pemphigus. A prospective cohort study was conducted at the Dermatology Service of the Hospital Universitário Walter Cantídio of the Federal University of Ceará. All patients seen at the outpatient clinic between August 2000 and July 2001, with a clinically and histologically confirmed diagnosis of pemphigus were included. The median age was 42.5 years (range: 12-69 years) with a male to female ratio of 3:2. Total serum nitrite levels, used as a marker for NO production, were determined by the Griess reaction. Skin biopsies from pemphigus and breast surgery (control) patients were used for the detection of the inducible NO synthase (iNOS) by immunohistochemistry. Twenty-two (22) patients with pemphigus and eight (8) controls who did not differ in demographic characteristics were included. Total serum nitrite levels were significantly higher (>7 µmol/L) in pemphigus patients compared to controls (<6 µmol/L), regardless of the severity of the clinical activity of pemphigus (P < 0.0001). All pemphigus biopsies presented increased immunostaining for iNOS that was not detected in normal skin samples. These data are the first to demonstrate that pemphigus patients display increased serum NO levels that are associated with increased iNOS expression in the affected skin.

IgE cross-reactivity between Lolium multiflorum and commercial grass pollen allergen extracts in Brazilian patients with pollinosis

Lolium multiflorum (Lm) grass pollen is the major cause of pollinosis in Southern Brazil. The objectives of this study were to investigate immunodominant components of Lm pollen allergens and the cross-reactivity of IgE with commercial grass pollen allergen extracts. Thirty-eight serum samples from patients with seasonal allergic rhinitis (SAR), 35 serum samples from patients with perennial allergic rhinitis (PAR) and 30 serum samples from non-atopic subjects were analyzed. Allergen sensitization was evaluated using skin prick test and serum IgE levels against Lm pollen extract were determined by ELISA. Inhibition ELISA and immunoblot were used to evaluate the cross-reactivity of IgE between allergens from Lm and commercial grass pollen extracts, including L. perenne (Lp), grass mix I (GI) and II (GII) extracts. IgE antibodies against Lm were detected in 100% of SAR patients and 8.6% of PAR patients. Inhibition ELISA demonstrated IgE cross-reactivity between homologous (Lm) and heterologous (Lp or GII) grass pollen extracts, but not for the GI extract. Fifteen IgE-binding Lm components were detected and immunoblot bands of 26, 28-30, and 32-35 kDa showed >90% recognition. Lm, Lp and GII extracts significantly inhibited IgE binding to the most immunodominant Lm components, particularly the 55 kDa band. The 26 kDa and 90-114 kDa bands presented the lowest amount of heterologous inhibition. We demonstrated that Lm extract contains both Lm-specific and cross-reactive IgE-binding components and therefore it is suitable for measuring quantitative IgE levels for diagnostic and therapeutic purposes in patients with pollinosis sensitized to Lm grass pollen rather than other phylogenetically related grass pollen extracts.

Clinical and immunological features of patients with atopy and concomitant HTLV-1 infection

Human T-cell lymphotropic virus type 1 (HTLV-1) induces an exacerbated type 1 immune response characterized by high spontaneous IFN-γ and TNF-α production. Allergic rhinitis and asthma are associated with the type 2 immune response, with elevated secretion of IL-4 and IL-5. The aim of this study was to characterize the immune response in atopic HTLV-1 carriers. The cytokine profile of atopic HTLV-1 carriers (N = 10; all females) was compared with that of non-atopic HTLV-1 carriers (N = 14; 9 females and 5 males). Mean patient age of atopic and non-atopic groups was 45 ± 8 and 38 ± 11 years, respectively. All atopic HTLV-1 carriers had rhinitis with or without asthma and a skin prick test positive for Dermatophagoides pteronyssinus antigen 1 (Derp-1). There was no difference in cytokine levels between the two groups in unstimulated peripheral blood mononuclear cell cultures. In cultures stimulated with Derp-1, IFN-γ levels tended to be higher (P = 0.06) and IL-5 levels were higher (P = 0.02) in atopic HTLV-1 patients than in non-atopic subjects. In contrast, IL-10 was lower (P = 0.004) in atopic than in non-atopic HTLV-1-infected subjects. This study shows that HTLV-1 infection with an exaggerated type 1 immune response does not prevent atopy. In this case, the exacerbated type 1 and type 2 immune responses were due to a lack of IL-10 production, a cytokine that plays an important role in down-modulating type 1 and type 2 immune responses and in preventing the development of chronic inflammatory diseases.

Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.