The effect of different training systems on vegetative and productive performance of apple trees cultivar 'maxigala' - in southern Brazil.

2016

Identification of a novel a-L-arabinofuranosidase gene associated with mealiness in apple.

In order to investigate the genetic bases of the physiological syndrome mealiness that causes abnormal fruit softening and juice loss in apples, an integrative approach was devised, consisting of sensory, instrumental, biochemical, genetic, and genomic methods. High levels of activity of a-L-arabinofuranosidase (a-AFase), a hydrolase acting on the pectic component of the cell walls, were found in individuals exhibiting the mealiness phenotype in a segregating population. The expression levels of the previously uncharacterized apple AF gene MdAF3 are higher in fruits from plants consistently showing mealiness symptons and high a-AFase activity. The transcription of MdAF3 is differentially regulated in distinct genomic contexts and appears to be independent of ethylene. Thus, it is likely to be controlled by endogenous developmental mechanisms associated with fruit ripening. The use of integrative approaches has allowed the identification of a novel contributor to the mealiness phenotype in apple and it has been possible to overcome the problems posed by the unavailability of near-isogenic lines to dissect the genetic bases of a complex physiological trait in woody perennial species.

Appleclim project: innovative approaches to develop apple cultivars adapted to the Southern-Brazilian climatic conditions.

2011

Evaluation of the productive and vegetative aspects of the cultivar 'Imperial Gala' apple tree with EM-9 interstem in different lengths.

The obtaining of a compact plant, with less vigor and high productivity, equivalent to a conventional plant, constitutes a strong tendency in the current horticulture, aiming at a raising of the fruit production at the same planted area. One of the techniques that have had success nowadays is the interstem use. This study was developed in a commercial orchard of Randon Agro Silvo Pastoril S.A. (RASIP), located in the Rio Grande do Sul state, Brazil. The purpose of this work was to evaluate the vegetative and productive development of apple trees of 'Imperial Gala' with different lengths of EM-9 interstem. The treatments consisted of five interstem lengths: 10, 15, 20, 25, 30 cm. In the seventh year of implantation the following parameters were evaluated: the height of the plant, the diameter of the 'Imperial Gala' 5 cm above the second graft point, the volume of the tree-head (height, width and length), the number of bud per branch, and the number of fruits per lineal centimeter of branch. Through this study it could be concluded that the greater interstem (30 cm) presented better indices with relation of vigor control. However, the number of fruits per lineal centimeter of branch with the interstem of 10 cm offered only significant superiority, when compared with the interstem of 30 cm. Using interstem technique allows to gather the benefits of the rootstock 'Marubakaido' and to control excessive vigour with the interstem EM-9.

Characterization of the chestnut germoplasm of Emilia-Romagna region and ancient fruit tree varieties valorization

Molecular characterization represents a valid support for the recovery of germoplasm, also motivated by the interest for the valorization of local productions in order to make their traceability possible. Molecular characterization is also fundamental for the individuation of misnomers in collection fields in which the different varieties are preserved. In particular, microsatellites have been used in this research to investigate the genetic diversity, inside a population and at an individual level, and the correct varietal correspondence. The research is mainly based on the study of European chestnut (Castanea sativa Mill.) cultivars to evaluate the genetic diversity and relationships in Emilia-Romagna region (Italy). A STRUCTURE analysis was carried out at European level with the allelic frequencies of the samples collected in Emilia-Romagna. Variation found at group and subgroup level may reflect a combination of historical migration/selection processes and adaptive factors to different environments between Italian and Spanish regions. In addition, a case study for the valorization of an old local variety and its re-introduction in the cultivation areas was proposed. This research was carried out by a morphological and molecular characterization of the local apple variety 'Rosa Romana'. The conservation of this variety entails the discrimination of different accessions with very similar phenotype that are present in the original cultivation area. The identification of historical trees and most adequate reference plants are fundamental steps for the correct propagation of this old variety and for the development of nursery activities. This will also promote and re-evaluate the exploitation and protection of such ancient Italian apple cultivars. This model could be in future also carried out for chestnut varieties. In conclusion, analysis with molecular markers is of fundamental importance for the protection and the maintenance of local and ancient varieties which allow to increase the allelic variability available for breeding programs.

Evaluation of a 2D multileader training system for improving sustainability and precision orchard management applications in italian apple orchards

The presented study aimed to evaluate the productive and physiological behavior of a 2D multileader apple training systems in the Italian environment both investigating the possibility to increase yield and precision crop load management resolution. Another objective was to find valuable thinning thresholds guaranteeing high yields and matching fruit market requirements. The thesis consists in three studies carried out in a Pink Lady®- Rosy Glow apple orchard trained as a planar multileader training system (double guyot). Fruiting leaders (uprights) dimension, crop load, fruit quality, flower and physiological (leaf gas exchanges and fruit growth rate) data were collected and analysed. The obtained results found that uprights present dependence among each other and as well as a mutual support during fruit development. However, individual upright fruit load and upright’s fruit load distribution on the tree (~ plant crop load) seems to define both upright independence from the other, and single upright crop load effects on the final fruit quality production. Correlations between fruit load and harvest fruit size were found and thanks to that valuable thinning thresholds, based on different vegetative parameters, were obtained. Moreover, it comes out that an upright’s fruit load random distribution presents a widening of those thinning thresholds, keeping un-altered fruit quality. For this reason, uprights resulted a partially physiologically-dependent plant unit. Therefore, if considered and managed as independent, then no major problems on final fruit quality and production occurred. This partly confirmed the possibility to shift crop load management to single upright. The finding of the presented studies together with the benefits coming from multileader planar training systems suggest a high potentiality of the 2D multileader training systems to increase apple production sustainability and profitability for Italian apple orchard, while easing the advent of automation in fruit production.

Adapting fruit production to climate change: how to increase intrinsic fruit quality and save water through deficit irrigation scheduling.

Fruit crops are an important resource for food security, since more than being nutrient they are also a source of natural antioxidant compounds, such as polyphenols and vitamins. However, fruit crops are also among the cultivations threatened by the harmful effects of climate change This study had the objective of investigating the physiological effects of deficit irrigation on apple (2020-2021), sour cherry (2020-2021-2022) and apricot (2021-2022) trees, with a special focus on fruit nutraceutical quality. On each trial, the main physiological parameters were monitored along the growing season: i) stem and leaf water potentials; ii) leaf gas exchanges; iii) fruit and shoot growth. At harvest, fruit quality was evaluated especially in terms of fruit size, flesh firmness and soluble solids content. Moreover, it was performed: i) total phenolic content determination; ii) anthocyanidin concentration evaluation; and iii) untargeted metabolomic study. Irrigation scheduling in apricot, apple and sour cherry is surely overestimated by the decision support system available in Emilia-Romagna region. The water stress imposed on different fruit crops, each during two years of study, showed as a general conclusion that the decrease in the irrigation water did not show a straightforward decrease in plant physiological performance. This can be due to the miscalculation of the real water needs of the considered fruit crops. For this reason, there is the need to improve this important tool for an appropriate water irrigation management. Furthermore, there is also the need to study the behaviour of fruit crops under more severe deficit irrigations. In fact, it is likely that the application of lower water amounts will enhance the synthesis of specialized metabolites, with positive repercussion on human health. These hypotheses must be verified.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Comparison Of Techniques For The Isolation Of Volatiles From Cashew Apple Juice.

The aim of this study was to compare the performance of the following techniques on the isolation of volatiles of importance for the aroma/flavor of fresh cashew apple juice: dynamic headspace analysis using PorapakQ(®) as trap, solvent extraction with and without further concentration of the isolate, and solid-phase microextraction (fiber DVB/CAR/PDMS). A total of 181 compounds were identified, from which 44 were esters, 20 terpenes, 19 alcohols, 17 hydrocarbons, 15 ketones, 14 aldehydes, among others. Sensory evaluation of the gas chromatography effluents revealed esters (n = 24) and terpenes (n = 10) as the most important aroma compounds. The four techniques were efficient in isolating esters, a chemical class of high impact in the cashew aroma/flavor. However, the dynamic headspace methodology produced an isolate in which the analytes were in greater concentration, which facilitates their identification (gas chromatography-mass spectrometry) and sensory evaluation in the chromatographic effluents. Solvent extraction (dichloromethane) without further concentration of the isolate was the most efficient methodology for the isolation of terpenes. Because these two techniques also isolated in greater concentration the volatiles from other chemical classes important to the cashew aroma, such as aldehydes and alcohols, they were considered the most advantageous for the study of cashew aroma/flavor.

Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.99580%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.