995 resultados para insetos necrófagos
Resumo:
A produção de uvas destinadas ao consumo in natura corresponde aproximadamente a 43% do total produzido no Brasil, e está localizada em Estados das Regiões Nordeste, Sul e Sudeste. Uma parcela expressiva dessa produção é destinada à exportação, sendo 90%oriunda da região do Vale do Rio São Francisco, em [uazeiro, BA, e Petrolina, PE. Dentre os insetos-praga prejudiciais ao cultivo de uvas de mesa estão incluídas algumas espécies de cochonilhas-farinhentas e de moscas-das-frutas, que são quarentenárias, o que faz com que o manejo de insetos e de ácaros-praga receba atenção diferenciada. Outro aspecto diz respeito aos métodos de controle de pragas, que, cada vez mais, necessitam ser sustentáveis e que não deixem resíduos, diante de um mercado consumidor cada vez mais exigente.
Resumo:
2015
Resumo:
2008
Resumo:
2016
Resumo:
Este projeto tem como objetivo estabelecer colônias de insetos Conotrachelus sp. para estudos de ecologia química das brocas do cupuaçu.
Resumo:
Muitas plantas produzem alguns tipos de substancias, denominados de compostos secundários, que são utilizados por essas espécies que os produzem, como uma forma de defesa contra alguns herbívoros. Essas substancias, costumam apresentar atividades mais especificas, e sabe-se que a maioria deles são facilmente decompostos, quando colocados no meio ambiente. Essas características, quando em nível não exagerado, são qualidades desejáveis para evitar que atinjam organismos não alvos e que acumulem no ambiente. Neste trabalho estamos avaliando a atividade de cerca de 30 espécies de plantas de diferentes regiões do Brasil, utilizando-se como inseto teste, lagartas de Spodoptera frugiperda, que foram eleitas por serem polífagas. Nessas espécies vegetais serão ainda pesquisados os grupos de substancias presentes, através de reações químicas especificas e será verificado seu relacionamento com as atividades, quando houver. Inicialmente foram preparados apenas um tipo de extrato das diferentes partes do vegetal, por percolacao, que foram testados em lagartas de 5o. instar, quanto a deterrencia, impregnando discos de folhas de milho, com o extrato. No final de duas horas os discos foram retirados e procedida a medida de sua área foliar. Os dados foram avaliados comparando-se o consumo da área foliar dos discos tratados e não tratados. Após esse teste, as lagartas são alimentadas por mais 24 horas com o material impregnado com o extrato, e são anotadas as mortalidades. O desenvolvimento das lagartas são acompanhadas até sua muda final. Quando observada atividade deterrente ou mortalidade, são preparados extratos com diferentes tipos de solventes, para avaliar a fração ativa. Ate o momento foram observadas atividades deterrente e inseticida em algumas espécies de plantas do Pantanal e estamos verificando a concentração necessária para se obter essas atividades.
Resumo:
2016
Resumo:
2016
Resumo:
2016
Resumo:
In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
In specialized literature, reports on anatomy of miners in host plants are few in number. These agents trigger excavations, or paths, by consumption of plant inner tissues by larvae of several insects. The aim of this work was to investigate leaf miner occurrence in Commelina diffusa (a cosmopolitan plant) and Floscopa glabrata (an amphibious plant) using anatomical techniques. The place where the plants were collected is subjected to seasonal floods, consequently both the species were exposed to the same weather conditions and seasonal floods. This study showed that members of Agromyzidae and Chironomidae families, which are Diptera endophytophagous larvae types, were responsible for the tunnels. Moreover, in Commelina diffusa Agromyzidae larvae were found, while in Floscopa glabrata three Chironomidae cephalic exuviae were found. The miners, as can be seen from anatomical studies, used only mesophyll parenchyma tissues for feeding, causing the formation of linear mines. In addition, in both the species, the epidermis and the medium-sized vascular units were kept intact, showing no structural modification, such as neoformation of tissues.
Resumo:
Piperaceae species have been placed among the basal angiosperm and are adapted to a variety of habitats including moist forests, secondary vegetation and dry high lands. The major anatomical/morphology features are of small trees, vines, and shrubs for Piper species, while the epiphytic and succulent characteristics are predominant forms among Peperomia species. Their secondary chemistry can be mostly represented by amides, phenylpropanoids/lignoids, and chromenes in addition to a phletoria of biosynthetically mixed-origin secondary compounds. Although several amides and lignans are known as insecticides, several phytophagous insects, among which some considered pests of economic importance, have been observed feeding vigorously on Piperaceae species. Herein we describe the feeding preferences of fourteen phytophagous species of Coleoptera, Lepidoptera and Hemiptera over approximately fifty Piperaceae species observed in São Paulo, SP, Brazil, in a long-term basis.