Comparative quantification of umbilical cord blood CD34+ and CD34+ bright cells using the ProCount™-BD and ISHAGE protocols

The total number of CD34+ cells is the most relevant clinical parameter when selecting human umbilical cord blood (HUCB) for transplantation. The objective of the present study was to compare the two most commonly used CD34+ cell quantification methods (ISHAGE protocol and ProCount™ - BD) and analyze the CD34+ bright cells whose 7-amino actinomycin D (7AAD) analysis suggests are apoptotic or dead cells. Twenty-six HUCB samples obtained at the Placental Blood Program of New York Blood Center were evaluated. The absolute numbers of CD34+ cells evaluated by the ISHAGE (with exclusion of 7AAD+ cells) and ProCount™ (with exclusion of CD34+ bright cells) were determined. Using the ISHAGE protocol we found 35.6 ± 19.4 CD34+ cells/µL and with the ProCount™ method we found 36.6 ± 23.2 CD34+ cells/µL. With the ProCount™ method, CD34+ bright cell counts were 9.3 ± 8.2 cells/µL. CD34+ bright and regular cells were individually analyzed by the ISHAGE protocol. Only about 1.8% of the bright CD34+ cells are alive, whereas a small part (19.0%) is undergoing apoptosis and most of them (79.2%) are dead cells. Our study showed that the two methods produced similar results and that 7AAD is important to exclude CD34 bright cells. These results will be of value to assist in the correct counting of CD34+ cells and to choose the best HUCB unit for transplantation, i.e., the unit with the greatest number of potentially viable stem cells for the reconstitution of bone marrow. This increases the likelihood of success of the transplant and, therefore, the survival of the patient.

Tissue transglutaminase (TG2) activity regulates osteoblast differentiation and mineralization in the SAOS-2 cell line

Tissue transglutaminase (type II, TG2) has long been postulated to directly promote skeletal matrix calcification and play an important role in ossification. However, limited information is available on the expression, function and modulating mechanism of TG2 during osteoblast differentiation and mineralization. To address these issues, we cultured the well-established human osteosarcoma cell line SAOS-2 with osteo-inductive conditioned medium and set up three time points (culture days 4, 7, and 14) to represent different stages of SAOS-2 differentiation. Osteoblast markers, mineralization, as well as TG2 expression and activity, were then assayed in each stage. Furthermore, we inhibited TG activity with cystamine and then checked SAOS-2 differentiation and mineralization in each stage. The results showed that during the progression of osteoblast differentiation SAOS-2 cells presented significantly high levels of osteocalcin (OC) mRNA, bone morphogenetic protein-2 (BMP-2) and collagen I, significantly high alkaline phosphatase (ALP) activity, and the increased formation of calcified matrix. With the same tendency, TG2 expression and activity were up-regulated. Furthermore, inhibition of TG activity resulted in a significant decrease of OC, collagen I, and BMP-2 mRNA and of ALP activity and mineralization. This study demonstrated that TG2 is involved in osteoblast differentiation and may play a role in the initiation and regulation of the mineralization processes. Moreover, the modulating effects of TG2 on osteoblasts may be related to BMP-2.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Follicular helper T cell in immunity and autoimmunity

The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.

Apatite-Polymer Composite Particles for Controlled Delivery of BMP-2: In Vitro Release and Cellular Response

Bone morphogenetic protein-2 (BMP-2) has the ability to induce osteoblast differentiation of undifferentiated cells, resulting in the healing of skeletal defects when delivered with a suitable carrier. We have applied a versatile delivery platform comprising a novel composite of two biomaterials with proven track records – apatite and poly(lactic-co-glycolic acid) (PLGA) – to the delivery of BMP-2. Sustained release of this growth factor was tuned with variables that affect polymer degradation and/or apatite dissolution, such as polymer molecular weight, polymer composition, apatite loading, and apatite particle size. The effect of released BMP-2 on C3H10T1/2 murine pluripotent mesenchymal cells was assessed by tracking the expression of osteoblastic makers, alkaline phosphatase (ALP) and osteocalcin. Release media collected over 100 days induced elevated ALP activity in C3H10T1/2 cells. The expression of osteocalcin was also upregulated significantly. These results demonstrated the potential of apatite-PLGA composite particles for releasing protein in bioactive form over extended periods of time.

Gut fermentation products of insulin-derived prebiotics beneficially modulate markers of tumour progression in human colon tumour cells

Insulin is a prebiotic food ingredient, which suppresses colon tumour growth and development in rats. In the gut lumen, it is fermented to lactic acid and short chain fatty acids (SCFA). Of these, butyrate has suppressing agent activities, but little is known concerning cellular responses to complex fermentation samples. To investigate the effects of fermentation products of insulin on cellular responses related to colon carcinogenesis. Fermentations were performed in anaerobic batch cultures or in a three-stage fermentation model that simulates conditions in colon-segments (proximal, transverse, distal). Substrate was insulin enriched with oligofructose (Raftilose® Synergy1), fermented with probiotics (Bifidobacterium lactis Bb12, Lactobacillus rhamnosus GG), and/or faecal inocula. HT29 or CaCo-2 cells were incubated with supernatants of the fermented samples (2.5%-25% v/v, 24-72 hours). Cellular parameters of survival, differentiation, tumour progression, and invasive growth were determined. Fermentation supernatants derived from probiotics and Synergy1 were more effective than with glucose. The additional fermentation with faecal slurries produced supernatants with lower toxicity, higher SCFA contents, and distinct cellular functions. The supernatant derived from the gut model vessel representing the distal colon, was most effective for all parameters, probably on account of higher butyrate-concentrations. Biological effects of insulin upon colon cells may be mediated not only by growth stimulation of the lactic acid-producing bacteria and/or production of butyrate, but also by other bacteria and products of the gut lumen. These newly reported properties of the supernatants to inhibit growth and metastases in colon tumour cells are important mechanisms of tumour suppression.

MARCKS functions as a novel growth/tumour suppressor in cells of melanocyte origin

Protein kinase C (PKC) plays a pivotal role in modulating the growth of melanocytic cells in culture. We have shown previously that a major physiological substrate of PKC, the 80 kDa myristoylated alanine-rich C-kinase substrate (MARCKS), can be phosphorylated in quiescent, non-tumorigenic melanocytes exposed transiently to a biologically active phorbol ester, but cannot be phosphorylated in phorbol ester-treated, syngeneic malignant melanoma cells. Despite its ubiquitous distribution, the function of MARCKS in cell growth and transformation remains to be demonstrated clearly. We report here that MARCKS mRNA and protein levels are down-regulated significantly in the spontaneously derived murine B16 melanoma cell line compared with syngeneic normal Mel-ab melanocytes. In contrast, the tumourigenic v-Ha-ras-transfonned melan-ocytic line, LTR Ras 2, showed a high basal level of MARCKS phosphorylation which was not enhanced by treatment of cells with phorbol ester. Furthermore, protein levels of MARCKS in LTR Ras 2 cells were similar to those expressed in Mel-ab melanocytes. However, in four out of six murine tumour cell lines investigated, levels of MARCKS protein were barely detectable. Transfection of B16 cells with a plasmid containing the MARCKS cDNA in the sense orientation produced two neomycin-resistant clones displaying reduced proliferative capacity and decreased anchorage-independent growth compared with control cells. In contrast, transfection with the antisense MARCKS construct produced many colonies which displayed enhanced growth and transforming potential compared with control cells. Thus, MARCKS appears to act as a novel growth suppressor in the spontaneous transformation of cells of melanocyte origin and may play a more general role in the tumour progression of other carcinomas.

Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) mediates post-endocytic trafficking of protease-activated receptor 2 and calcitonin receptor-like receptor

The E3 ligase c-Cbl ubiquitinates protease-activated receptor 2 (PAR(2)), which is required for post-endocytic sorting of PAR(2) to lysosomes, where degradation arrests signaling. The mechanisms of post-endocytic sorting of ubiquitinated receptors are incompletely understood. Here, we investigated the role of hepatocyte growth factor-regulated tyrosine kinase substrate (HRS), in post-endocytic sorting and signaling of PAR(2). In HEK-PAR(2) cells, PAR(2) activating peptide (PAR(2)-AP) induced PAR(2) trafficking from the cell surface to early endosomes containing endogenous HRS, and then to lysosomes. HRS overexpression or knockdown with small interfering RNA caused formation of enlarged HRS-positive endosomes, where activated PAR(2) and c-Cbl accumulated, and PAR(2) failed to traffic to lysosomes. Overexpression of HRS prevented PAR(2)-AP-induced degradation of PAR(2), as determined by Western blotting. Overexpression of HRS mutant lacking an ubiquitin-binding motif similarly caused retention of PAR(2) in enlarged endosomes. Moreover, HRS overexpression or knockdown caused retention of ubiquitin-resistant PAR(2)Delta14K/R in enlarged HRS-containing endosomes, preventing recycling and resensitization of PAR(2)Delta14K/R. HRS overexpression or knockdown similarly prevented lysosomal trafficking and recycling of calcitonin receptor-like receptor, a non-ubiquitinated receptor that traffics to lysosomes after sustained activation and recycles after transient activation. Thus, HRS plays a critically important role in the post-endocytic sorting of single receptors, PAR(2) and CLR, to both degradative and recycling pathways. This sorting role for HRS is independent of its ubiquitin-interacting motif, and it can regulate trafficking of both ubiquitinated and non-ubiquitinated PAR(2) and non-ubiquitinated CLR. The ultimate sorting decision to degradative or recycling pathways appears to occur downstream from HRS.

The effect of polyoxyethylene polymers on the transport of ranitidine in Caco-2 cell monolayers.

Previous in vivo studies using PEG 400 showed an enhancement in the bioavailability of ranitidine. This study investigated the effect of PEG 200, 300 and 400 on ranitidine transport across Caco-2 cells. The effect of PEG polymers (20%, v/v) on the bi-directional flux of (3)H-ranitidine across Caco-2 cell monolayers was measured. The concentration dependence of PEG 400 effects on ranitidine transport was also studied. A specific screen for P-glycoprotein (P-gp) activity was used to test for an interaction between PEG and P-gp. In the absence of PEG, ranitidine transport showed over 5-fold greater flux across Caco-2 monolayers in the secretory than the absorptive direction; efflux ratio 5.38. PEG 300 and 400 significantly reduced this efflux ratio (p<0.05), whereas PEG 200 had no effect (p>0.05). In concordance, PEG 300 and 400 showed an interaction with the P-gp transporter, whereas PEG 200 did not. Interestingly, with PEG 400 a non-linear concentration dependence was seen for the inhibition of the efflux ratio of ranitidine, with a maxima at 1%, v/v (p<0.05). The inhibition of ranitidine efflux by PEG 300 and 400 which interact with P-gp provides a mechanism that may account for the observations of ranitidine absorption enhancement by PEG 400 in vivo.

ATP pulse and calcium homeostasis in cells from hepatopancreas of Dilocarcinus pagei, a freshwater crab

Calcium (Ca) is critical for crustaceans due to their molting cycle and its presence in the carapace as calcium carbonate, apart from the usual functions of Ca, such as cell signalling. Ca transport in Dilocarcinus pagei, a freshwater crab, was studied in isolated cells from hepatopancreas to further characterize Ca transport mechanisms in these crabs. Cells were isolated and loaded with Fluo-3, a calcium fluorescent dye. Three different cell treatments were performed: Group 1 cells were Ca free during cell dissociation, and calcium was present (at 1mM) for fluorescence cell loading and transport experiments (FC); Group 2 cells were calcium free during cell dissociation and for transport experiments, but not during cell loading (LC); and Group 3 cells were Ca free during cell dissociation, cell loading and transport experiments (WC). Intracellular Ca was recorded through time after ATP was added to the cells and ATP caused an increase in Ca efflux within 30s in all cells. WC cells showed the smallest Ca efflux compared to the other cells, probably because it was intracellularly Ca ""depleted"". Vanadate and amiloride decreased the Ca efflux when ATP was added to the cells, while verapamil did not cause any effect in Ca efflux, confirming the presence of a Ca(2+)-ATPase sensitive to vanadate in hepatopancreas of D. pagei. In a different set of experiments, cells were also exposed to a Ca pulse of 1 and 10mM during 180s. 10mM Ca increased intracellular Ca compared to 1mM, and the increase was not recovered during the experimental time. Additionally, Ca influx was reduced by verapamil and amiloride, but not completely. The results suggest that Ca influx probably occurs through an undefined exchanger, apart from Ca channels (verapamil sensitive) and electrogenic 1Na(+)(1H(+))/1 Ca(2+) exchanger (amiloride-sensitive). Similarities between freshwater and seawater crabs, lobsters and crayfish in relation to plasma membrane Ca transporters, although the environment where they live is quite diverse, suggest that universal mechanisms for Ca homeostasis are widespread among crustaceans. (C) 2010 Elsevier Inc. All rights reserved.

The importance of hormone receptor analysis in osteosarcoma cells growth submitted to treatment with estrogen in association with thyroid hormone

Bone tumor incidence in women peaks at age 50-60, coinciding with the menopause. That estrogen (E2) and triiodothyronine (T3) interact in bone metabolism has been well established. However, few data on the action of these hormones are available. Our purpose was to determine the role of E2 and T3 in the expression of bone activity markers, namely alkaline phosphatase (AP) and receptor activator of nuclear factor kappa B ligand (RANKL). Two osteosarcoma cell lines: MG-63 (which has both estrogen (ER) and thyroid hormone (TR) receptors) and SaOs-29 (ER receptors only) were treated with infraphysiological E2 associated with T3 at infraphysiological, physiological, and supraphysiological concentrations. Real-time RT-PCR was used for expression analysis. Our results show that, in MG-63 cells, infraphysiological E2 associated with supraphysiological T3 increases AP expression and decreases RANKL expression, while infraphysiological E2 associated with either physiological or supraphysiological T3 decreases both AP and RANKL expression. On the other hand, in SaOs-2 cells, the same hormone combinations had no significant effect on the markers` expression. Thus, the analysis of hormone receptors was shown to be crucial for the assessment of tumor potential growth in the face of hormonal changes. Special care should be provided to patients with T3 and E2 hormone receptors that may increase tumor growth. Copyright (C) 2007 John Wiley & Sons, Ltd.

Three-Dimensional Quantitative Structure-Activity Relationship Study of Antitumor 2-Formylpyridine Thiosemicarbazones Derivatives as Inhibitors of Ribonucleotide Reductase

In order to extend previous SAR and QSAR studies, 3D-QSAR analysis has been performed using CoMFA and CoMSIA approaches applied to a set of 39 alpha-(N)-heterocyclic carboxaldehydes thiosemicarbazones with their inhibitory activity values (IC(50)) evaluated against ribonucleotide reductase (RNR) of H.Ep.-2 cells (human epidermoid carcinoma), taken from selected literature. Both rigid and field alignment methods, taking the unsubstituted 2-formylpyridine thiosemicarbazone in its syn conformation as template, have been used to generate multiple predictive CoMFA and CoMSIA models derived from training sets and validated with the corresponding test sets. Acceptable predictive correlation coefficients (Q(cv)(2) from 0.360 to 0.609 for CoMFA and Q(cv)(2) from 0.394 to 0.580 for CoMSIA models) with high fitted correlation coefficients (r` from 0.881 to 0.981 for CoMFA and r(2) from 0.938 to 0.993 for CoMSIA models) and low standard errors (s from 0.135 to 0.383 for CoMFA and s from 0.098 to 0.240 for CoMSIA models) were obtained. More precise CoMFA and CoMSIA models have been derived considering the subset of thiosemicarbazones (TSC) substituted only at 5-position of the pyridine ring (n=22). Reasonable predictive correlation coefficients (Q(cv)(2) from 0.486 to 0.683 for CoMFA and Q(cv)(2) from 0.565 to 0.791 for CoMSIA models) with high fitted correlation coefficients (r(2) from 0.896 to 0.997 for CoMFA and r(2) from 0.991 to 0.998 for CoMSIA models) and very low standard errors (s from 0.040 to 0.179 for CoMFA and s from 0.029 to 0.068 for CoMSIA models) were obtained. The stability of each CoMFA and CoMSIA models was further assessed by performing bootstrapping analysis. For the two sets the generated CoMSIA models showed, in general, better statistics than the corresponding CoMFA models. The analysis of CoMFA and CoMSIA contour maps suggest that a hydrogen bond acceptor near the nitrogen of the pyridine ring can enhance inhibitory activity values. This observation agrees with literature data, which suggests that the nitrogen pyridine lone pairs can complex with the iron ion leading to species that inhibits RNR. The derived CoMFA and CoMSIA models contribute to understand the structural features of this class of TSC as antitumor agents in terms of steric, electrostatic, hydrophobic and hydrogen bond donor and hydrogen bond acceptor fields as well as to the rational design of this key enzyme inhibitors.

Resposta celular Th1 /Th2 na doença periodontal experimental, em ratos: um estudo imuno-histoquímico

Host response plays a major role in the pathogenesis of periodontal disease. Mediators such as inflammatory cytokines which are secreted during the immune response to bacterial challenges have ambiguous functions that may or may not lead to protection of the attacked tissue. In this context, experimental evidence suggests that T-helper 1 (Th-1) and T-helper 2 (Th-2) mediated responses are potentially important during the disease process. The aims of this study therefore were to further clarify the role played by Th2 cells during different time points of the active phase of periodontal disease, as well as, to investigate whether there was any evidence of a Th1 response in the periodontal disease microenvironment. Experimental periodontitis was induced in 30 Wistar male rats by placing cotton ligatures around the mandibular first molars. The rats were then randomly divided into two groups. Group1 (G1=15) and Group 2 (G2=15). In G1 the ligatures were maintained for 2 days, whereas in G2 the ligatures were left for 15 days, a time point that corresponds to the advanced stage of periodontal disease The contra-lateral teeth served as controls (no ligatures). Immunohistochemical investigation for the presence in gingival tissue of Th2 specific transcription factor (GATA3) and the subunit of the IFN-γ receptor was carried out after the disease induction period. Light microscopy analysis revealed a decrease in the expression of GATA-3 as bone loss progressed. On the other hand, although IFN-γ R1 was detected at an early stage of the active phase of disease its expression remained unaltered during the remaining period of the study. These results indicate that the Th2 response have a protective role during the pathogenesis of periodontal disease and that the progression of the periodontal disease is related with the unbalance of the responses Th1/Th2

Platelet-rich plasma stimulates cytokine expression and alkaline phosphatase activity in osteoblast-derived osteosarcoma cells

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Annexin 1: differential expression in tumor and mast cells in human larynx cancer

Annexin 1 protein (ANXA1) expression was evaluated in tumor and mast cells in human larynx cancer and control epithelium. The effect of the exogenous ANXA1 (peptide Ac 2-26) was also examined during the cellular growth of the Hep-2 human larynx epidermoid carcinoma cell line. This peptide inhibited the proliferation of the Hep-2 cells within 144 hr. In surgical tissue specimens from 20 patients with larynx cancer, ultrastructural immunocytochemistry analysis showed in vivo down-regulation of ANXA1 expression in the tumor and increased in mast cells and Hep-2 cells treated with peptide Ac2-26. Combined in vivo and in vitro analysis demonstrated that ANXA1 plays a regulatory role in laryngeal cancer cell growth. We believe that a better understanding of the regulatory mechanisms of ANXA1 in tumor and mast cells may lead to future biological targets for the therapeutic intervention of human larynx cancer. (c) 2007 Wiley-Liss, Inc.