The measured variation of the Debye-Waller factor of aluminum from 295K to 815K by using the energy dispersive x-ray diffraction technique

The Energy Dispersive X-ray Diffraction System at Brock University has been used to measure the intensities of the diffraction lines of aluminum powder sample as a function of temperature. At first, intensity measurements at high temperature were not reproducible. After some modifications have been made, we were able to measure the intensities of the diffraction lines to 815K, with good accuracy and reproducibility. Therefore the changes of the Debye-Waller factor from room temperature up to 815K for aluminum were determined with precision. Our results are in good agreement with those previously published.

X-ray diffraction studies of muscle : observations on the anterior byssus retractor muscle of Mytilus edulis and the insect flight muscle from Sarcophaga bullata

The interfilament spacing of the anterior byssus retractor muscle from Mytilus edulis was studied as the muscle was extended. It was found that variations in this spacing were very small and consistent with the hypothesis that the interfilament spacing was independent of the extension of the muscle. It was observed that the interfilament spacing was dependent on the osmolarity of the bathing medium. In concentrated solutions of the artificial seawater, the interfilament spacing decreased; while in dilute solutions of artificial seawater, it was observed that the interfilament spacing was increasing. X-ray diffraction patterns were obtained from fresh, and glutaraldehyde fixed, specimens of insect flight muscle from Sarcophaga bullata. There patterns were in general agreement with previous X-ray diffraction studies of insect flight muscle. A reflexion G at 93A was observed and interpreted as arising from diffraction in the mitochondria. Specimens of dried insect flight muscle produced a diffraction pattern consisting of arc and ring reflexions. This was interpreted as suggesting an ordered arrangement of cristae, in the mitochondria from these muscles.

X-ray diffraction from Al powder using energy dispersive technique

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

X-ray diffraction of a gram-negative bacterial membrane mimetic

This thesis applies x-ray diffraction to measure he membrane structure of lipopolysaccharides and to develop a better model of a LPS bacterial melilbrane that can be used for biophysical research on antibiotics that attack cell membranes. \iVe ha'e Inodified the Physics department x-ray machine for use 3.'3 a thin film diffractometer, and have lesigned a new temperature and relative humidity controlled sample cell.\Ve tested the sample eel: by measuring the one-dimensional electron density profiles of bilayers of pope with 0%, 1%, 1G :VcJ, and 100% by weight lipo-polysaccharide from Pse'udo'lTwna aeTuginosa. Background VVe now know that traditional p,ntibiotics ,I,re losing their effectiveness against ever-evolving bacteria. This is because traditional antibiotic: work against specific targets within the bacterial cell, and with genetic mutations over time, themtibiotic no longer works. One possible solution are antimicrobial peptides. These are short proteins that are part of the immune systems of many animals, and some of them attack bacteria directly at the membrane of the cell, causing the bacterium to rupture and die. Since the membranes of most bacteria share common structural features, and these featuret, are unlikely to evolve very much, these peptides should effectively kill many types of bacteria wi Lhout much evolved resistance. But why do these peptides kill bacterial cel: '3 , but not the cells of the host animal? For gramnegative bacteria, the most likely reason is that t Ileir outer membrane is made of lipopolysaccharides (LPS), which is very different from an animal :;ell membrane. Up to now, what we knovv about how these peptides work was likely done with r !10spholipid models of animal cell membranes, and not with the more complex lipopolysa,echaricies, If we want to make better pepticies, ones that we can use to fight all types of infection, we need a more accurate molecular picture of how they \vork. This will hopefully be one step forward to the ( esign of better treatments for bacterial infections.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.