998 resultados para entendimento


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Como estudar uma cultura ou uma comunidade perdida nos tempos bíblicos? Esta é um questão motriz para o autor. Foi dessa maneira que surgiu o seu interesse em discutir a possibilidade do uso do mito cosmogônico para o entendimento da comunidade dos cativos judaítas em Babilônia. É uma iniciativa, que precisava ser trilhada pelos pesquisadores que se dispusessem ao estudo das culturas do mundo bíblico. Assim se elegeu o tema Mito Cosmogônico no Primeiro Testamento como instrumento de aprofundamento da pesquisa bíblica. O mito é uma escolha mais ou menos óbvia, pela sua capacidade de funcionar como paradigma, pragmática e traditiva contra-hegemônica dentro de um contexto social interétnico. Estas eram ponderações vindas de matrizes como a do fenomenólogo Mircea Eliade, do Antropólogo Roger Bastide e do teólogo e fenomenólogo José Severino Croatto. É por isto que um paralelo é traçado entre o mito de Marduk e o texto de Isaías 51, 9-11, que fala de Javé como sendo criador do mundo e que luta contra as forças do caos. Isto é feito, com vistas à percepção da profecia do Isaías do exílio, como parentesco e sua justaposição com a mitologia babilônica, e ambos se aproximam bastante de forma sintagmática e histórico-social. Coube ainda saber se a profecia do Dêutero-Isaías atuava da mesma maneira que o poema Enuma elish funcionava para os babilônicos. Ou seja, fazia-se surgir modelos sociais às comunidades de escravos dentro do Império Neobabilônico; se com base nestes cânticos, os cativos conseguiam construir um ordenamento para as suas comunidades, que gozavam de uma relativa autonomia, tais como colônias e guetos ; se de posse dessa ousada profecia, os judeus da golah eram capazes de elaborar uma desobediência cívil nos termos de um nutrir nos corações, uma utopia que rompesse com o status quo do passado, comprometendo-os com a esperança no Javé criador.(AU)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dissertação de Mestrado, Ciências Sociais, 16 de Setembro de 2016, Universidade dos Açores.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The general objective of this study was to contribute to the understanding of the chemical evolution of fluids that percolate through carbonate rocks of the Jandaíra Formation. The oxidation and reduction conditions in which grains, source and cement were formed was investigated using the cathodoluminescence technique (CL). The study area is located in the west part of the Potiguar Basin (Fazenda Belém field) and Rosário Ledge (Felipe Guerra municipality, State of Rio Grande do Norte, Brazil). The analysis of thin sections of carbonate rocks under CL revealed that grains (allochemical or not) and diagenetic products (micritization, dolomitization, neomorphism and cementation) exhibit since absence of luminescence the various luminescence colors (yellow, orange, red, brown, and blue) in a variety of intensities. As pure calcite shows dark blue luminescence, the occurrence of different luminescence colors in calcite crystals suggest one or more punctual crystal defects such as free electron, free space and impurity. The dyeing of thin sections with alizarin and potassium ferrocyanide revealed the absence of ferrous carbonate in the different lithotypes of Jandaíra Formation. Therefore, the different colors and intensities of CL observed in these rocks are probably caused by the presence of ion activators such as Mn2+ and is not an activator/inhibitor combination. In the same way, the absence of luminescence is very probably caused by the absence of activator ions and not due to the low concentration of inhibitor ions such as Fe2+. The incorporation of Mn2+ in the different members of the Jandaíra Formation must have been controlled by the redox state of the depositional environment and diagenesis. Therefore, it is possible that the luminescent members have been formed (e.g.,ooids) or have been modified (gastropod neomorphism) under reduction conditions in the depositional environments, in subsurface during the burial, or, in the case of Rosario Ledge samples , during the post-burial return to surface conditions. As regards the sudden changes from low to moderate and to strong luminescence, these features should indicate the precipitation of a fluid with chemical fluctuations, which formed the frequent zonations in the block cement of the Rosario Ledge samples. This study suggests that the different intensities and colors of CL should be correlated with the Mn2+ and Fe2+ contents, and stable isotopes of samples to determine the salinity, temperature, pH e Eh conditions during deposition

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Em Portugal, apesar da sua reduzida diferenciação genética, existem 6 raças de caprinos: Algarvia, Bravia, Charnequeira, Preta de Montesinho, Serpentina e Serrana. É plausível que estas raças tenham origem em animais provenientes de diversas regiões da Península Ibérica (considerando a ocorrência histórica de transumância) e do Norte de África, com possível influência de raças de outras regiões (e.g. raças comerciais transfronteiriças). Este trabalho teve como objectivo uma reflexão sobre dados históricos, bem como resultados de estudos de diversidade genética realizados recentemente por diversos autores (ADN mitocondrial, microssatélites e cromossoma Y), no sentido de discutir as possíveis origens da raça Serpentina. Com solar na região do Alentejo, a raça Serpentina, de aptidão mista carne/leite, tem características fenotípicas distintas das outras raças autóctones Portuguesas. De pelagem branca com listão e cabos pretos, foi conhecida no passado por Espanhola, Castelhana e Raiana, apresentando semelhanças morfológicas evidentes com a raça Blanca Celtibérica do Centro-Sul de Espanha, nomeadamente com o ecótipo onde surgem animais com pelagem idêntica, chamados “Rayados”. No seu conjunto os dados actuais refletem as introduções de animais efectuadas ao longo do tempo nos efectivos. Os estudos de diversidade genética dos caprinos Ibéricos baseados em marcadores moleculares neutros (i.e. microssatélites) ilustram a proximidade entre estas duas raças, mas não refletem a totalidade das diferenças genéticas associadas à selecção de animais com base em caracteres produtivos. Revela-se importante considerar análises genómicas de forma a incorporar informação de caracteres morfológicos como, por exemplo, a coloração da pelagem na avaliação das relações genéticas entre raças caprinas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The authors present the study of four children with arteritis as vascular complication of acute bacterial meningitis. They report pathophysiological mechanisms involved in vascular lesions, and progress in the understanding of these complications.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física