1000 resultados para coloração das bagas
Resumo:
The development and use of techniques that extend the life vase of the flowers, maintaining the quality of the product, is essential for reducing postharvest losses. The objective of this work was to evaluate different solutions for maintenance, associated or not to sucrose, in maintaining the postharvest quality of chrysanthemum stems. The treatments used distilled water, 8-HQC to 100 mg L-1, 8-HQC to 100 mg L-1 + sucrose 50 g L-1, 8-HQC to 200 mg L-1, 8-HQC to 200 mg L-1 + sucrose 50 g L-1. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, color of the flowers, and number of buttons, open flowers and partially open flowers. The combination of 8-HQC 200 mg L-1 + sucrose 50 g L-1 was the best performance that made for maintaining the quality of flower stems, favoring the opening of buttons and turgidity of petals. Sucrose contributed to better maintenance of the reserve substances in the shaft, which had increased the flower vase life.
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.
Resumo:
OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.
Resumo:
Os efeitos da concentração de ágar no crescimento de explantes e na formação de calos foram avaliados em culturas axênicas de gametófitos femininos de morfos de coloração verde e vermelha de Gracilaria domingensis (Kützing) Sonder ex Dickie. Culturas unialgáceas foram mantidas em água do mar esterilizada (30-32 ups) enriquecida com 25% da solução de von Stosch (VSES 25%), 22 ± 2 °C, fotoperíodo de 14 h, irradiância de 50-80 µmol de fótons m-2 s-1. Para a obtenção de explantes axênicos, segmentos apicais e intercalares dos dois morfos foram cultivados por 48 h em meio VSES 25% com adição de uma solução antibiótica e antifúngica, e submetidos a uma lavagem com uma solução de água do mar esterilizada com 0,5% de hipoclorito de sódio e 200 µL L-1 de detergente por 20 segundos. Para avaliar os efeitos da concentração de ágar, os segmentos axênicos foram inoculados em meio ASP 12-NTA com concentrações distintas de ágar que variaram de zero a 1%. A adição de ágar no meio inibiu o crescimento dos segmentos apicais de ambos os morfos, bem como o crescimento de segmentos intercalares do morfo verde. Observou-se uma tendência geral no crescimento dos explantes, onde a taxa de crescimento foi inversamente proporcional à concentração de ágar. A adição de ágar no meio induziu a formação de três tipos de calo, denominados conforme a região do explante onde se originaram: calo apical, calo basal e calo intermediário. As concentrações de 0,5% e 0,7% de ágar foram as concentrações ótimas para indução de calos basais e calos intermediários no morfo verde, respectivamente. A presença de ágar foi essencial para a formação de calos intermediários e apicais. Os resultados indicam que o ágar apresenta um papel na regulação dos processos morfogenéticos em morfos pigmentares de G. domingensis.
Resumo:
A new species of the relatively poorly known Neotropical freshwater stingray genus Plesiotrygon Rosa, Castello & Thorson, 1987 is described from the main channel and smaller tributaries (Ríos Itaya and Pachitea) of the upper Amazon basin in Peru. The first specimen to be collected, however, was from much farther east in Rio Solimões in 1996, just down-river from Rio Purus (specimen unavailable for this study). Plesiotrygon nana sp. nov., is a very distinctive and unusually small species of freshwater stingray (Potamotrygonidae), described here mostly from three specimens representing different size classes and stages of sexual maturity. Plesiotrygon nana sp. nov., is distinguished from its only congener, P. iwamae Rosa, Castello & Thorson, 1987, by numerous unique features, including: dorsal coloration composed of very fine rosettes or a combination of spots and irregular ocelli; very circular disc and snout; very small and less rhomboidal spiracles; short snout and anterior disc region; narrow mouth and nostrils; denticles on dorsal tail small, scattered, not forming row of enlarged spines; adult and preadult specimens with significantly fewer tooth rows; fewer caudal vertebrae; higher total pectoral radials; very small size, probably not surpassing 250 mm disc length or width, males maturing sexually at around 180 mm disc length and 175 mm disc width; distal coloration of tail posterior to caudal stings usually dark purplish-brown; and features of the ventral lateral-line canals (hyomandibular canal very narrow, infraorbital and supraorbital canals not undulated, supraorbital and infraorbital loops small and narrow, supraorbital loop very short, not extending posteriorly to level of mouth, jugular and posterior infraorbital canals short, not extending caudally to first gill slits, subpleural loop very narrow posteriorly; absence of anterior and posterior subpleural tubules). To provide a foundation for the description of P. nana sp. nov., morphological variation in P. iwamae was examined based on all type specimens as well as newly collected and previously unreported material. Two specimens topotypic with the male paratype of P. nana sp. nov., referred to here as Plesiotrygon cf. iwamae, are also reported. Relationships of the new species to P. iwamae are discussed; further characters indicative of Plesiotrygon monophyly are proposed, but the genus may still not be valid. Plesiotrygon nana sp. nov., is commercialized with some regularity in the international aquarium trade from Iquitos (Peru), an alarming circumstance because nothing is known of its biology or conservation requirements.
Resumo:
Potamotrygon tatianae sp. nov., is described from Río Madre de Díos, Peru, upper Rio Madeira basin. The new species is distinguished from all congeners by a unique combination of characters, including its dorsal color pattern formed by a relatively slender, highly convoluted, beige to dark brown vermicular pattern, a single row of dorsal tail spines, and a relatively longer tail posterior to caudal stings. Potamotrygon tatianae sp. nov., occurs sympatrically with other species of Potamotrygon (P. falkneri, P. orbignyi and P. motoro). From the similar species P. falkneri, P. tatianae sp. nov., is further distinguished by the absence of circular, reniform, and oval spots, by its proportionally much longer tail, by having dorsal tail spines in one irregular row, and by features of the ventral lateral-line canal, dermal denticles and neurocranium. From P. orbignyi, the new species is distinct by lacking a reticulate pattern on dorsal disc and by the presence of two angular cartilages. From P. motoro, P. tatianae sp. nov., is further separated by the lack of ocelli formed by strong black concentric rings, by the more flattened aspect of its head and disc, and by having smaller and more numerous teeth. The discovery of a new species that so closely resembles a congeneric form in color pattern, a feature highly variable within the latter, highlights the importance of examining large series of individuals and of detailed morphological analyses in revealing the potentially highly cryptic nature of the diversity within the family.
Resumo:
A taxonomic revision of two nominal species of freshwater stingrays of the genus Potamotrygon previously considered valid, Potamotrygon falkneri Castex & Maciel, 1963 and Potamotrygon castexi Castello & Yagolkowski, 1969, was conducted based on a detailed analysis of external and internal morphology, including a morphometric and meristic study of specimens from the recorded range of both species. The taxonomic status of the nominal species P. menchacai Achenbach, 1967, treated by previous authors as a junior synonym of P. falkneri, was also evaluated. These nominal species, which constitute what has been called the falkneri-castexi complex, were found to represent examples of chromatic variation present in a single species, given that intermediate patterns of coloration are common and the remaining characters analyzed are not consistent enough for separation at the specific level. Consequently, Potamotrygon falkneri is considered valid, whereas the nominal species Potamotrygon castexi and Potamotrygon menchacai are concluded to be junior synonyms of P. falkneri. Additionally, a putative new species is identified from the río Madre de Díos in Peru, which has some characters that do not correspond to P. falkneri. This species, known from few individuals, is here provisionally treated as Potamotrygon sp.
Resumo:
Potamotrygon boesemani, new species, is described from the Corantijn river drainage in Surinam. The species has a diagnostic dorsal color pattern formed by deep orange to red ocellated spots of irregular form, encircled by relatively broad black rings. Potamotrygon boesemani is distinguished from other ocellated congeners (P. motoro, P. henlei and P. leopoldi) by the more intensely colored ocelli, which are usually yellow in the latter species. From P. motoro it is also distinguished by the darker dorsal background coloration, by the broader black contour of the dorsal ocelli, and by the irregular form of the ocelli as compared to the more rounded shape in the latter species. From P. henlei and P. leopoldi, it is distinguished by the lack of ocelli on tail. From the tentatively identified specimen of P. ocellata, which also has dark orange ocelli, the irregular contour of the ocelli in the new species is also distinctive. The teeth are relatively smaller and in greater number than in P. motoro and P. ocellata, with up to 45 rows in the upper jaw.
Resumo:
Cefalópodes coleóides (lulas, sépias e polvos) produzem espermatóforos muito complexos que são transferidos à fêmea durante a cópula por meio do hectocótilo, um apêndice modificado nos machos. Durante a transferência à fêmea, ocorre a chamada "reação espermatofórica", complexo processo de evaginação do aparato ejaculatório do espermatóforo, que conduz à exteriorização da massa espermática e corpo cimentante. A presente revisão sintetiza o conhecimento acerca da morfologia e funcionamento desta estrutura exclusiva dos coleóides, identificando lacunas e definindo estratégias que possibilitem avanços na área. Poucos trabalhos abordam com detalhes a morfologia e anatomia funcional dos espermatóforos dos cefalópodes, grande parte do conhecimento acerca da estrutura do espermatóforo tendo sido gerada por trabalhos clássicos do século XIX e início do século XX. Investigações acerca do funcionamento dos espermatóforos são consideravelmente mais raras, estando o conhecimento básico sobre a reação espermatofórica restrito a apenas 19 espécies de coleóides. A revisão da literatura especializada permite sugerir que existem dois tipos básicos de fixação de espermatóforos em Decapodiformes (lulas e sepióides): fixação superficial e implante profundo (ou intra-dérmico). Na fixação superficial, comum em diversas espécies (e.g., Loliginidae, Sepiidae, Ommastrephidae), a base dos espermatângios é aderida ao tecido-alvo aparentemente por meio do corpo cimentante, a partir de substâncias adesivas e, em alguns casos, estruturas de fixação. No implante profundo, comum em alguns grupos de lulas oceânicas e de águas profundas (e.g., Architeuthidae, Cranchiidae, Octopoteuthidae, Sepiolidae), os espermatóforos implantam-se inteiramente no corpo da fêmea, de forma autônoma. Permanece desconhecido o mecanismo responsável pelo implante profundo. Em Octopodiformes (polvos), o espermatóforo é inserido no gonoduto feminino, alcançando a glândula oviducal, onde estão localizadas as espermatecas, ou a cavidade do ovário. Como o funcionamento extracorpóreo dos espermatóforos depende exclusivamente da intrincada estrutura e organização de seus componentes (e.g., membranas e túnicas), somente investigações detalhadas dessas estruturas proverão as bases para a compreensão do funcionamento e da exata função do complexo espermatóforo dos coleóides. Recomenda-se o desenvolvimento de um protocolo simples e eficiente para coloração e preparação total de espermatóforos, de forma que seja possível expandir as descrições morfológicas do espermatóforo em estudos taxonômicos e anatômicos, permitindo, portanto, ampliação do conhecimento acerca desta enigmática estrutura.
Resumo:
Hemiancistrus cerrado is described from the tributaries of rio Araguaia, rio Tocantins basin. Hemiancistrus cerrado has external similarities with H. megalopteryx and H. punctulatus from coastal streams of southern Brazil, and can be distinguished by having a larger internarial width, 15.9-21.1% of head length (vs. 11.2-14.0% in H. megalopteryx and 11.2-13.9% in H. punctulatus) and, with little overlap, by the larger adipose-fin spine length, 9.4-13.6% of standard length (vs. 7.1-8.7% in H. megalopteryx and 7.4-10.0% in H. punctulatus). Hemiancistrus cerrado further differs from H. megalopteryx by having the pectoral-fin spine reaching maximally to the middle of the pelvic-fin spine when adpressed in adult males (vs. reaching tip). Hemiancistrus cerrado differs from other members of Hemiancistrus by color and numerous morphometric and meristic data.
Resumo:
Coctilelater minimus from Brazil (Pará) is described and illustrated. This new species is mainly characterized by small size and coloration pattern.
Resumo:
O desenvolvimento do sistema nervoso é bastante complexo, existindo poucos estudos sobre a organização dos envoltórios cerebrais relacionados ao crescimento encefálico. Utilizando como modelo experimental o rato, analisaram-se os diferentes aspectos estruturais e morfométricos da paquimeninge e leptomeninge durante o processo de envelhecimento. Foram utilizados quatro grupos de ratos em diferentes faixas etárias e analisadas as meninges em microscopias de luz e eletrônica. Verificamos que o grupo de ratos adultos apresentou uma maior área de fibras colágenas tanto do tipo I e quanto do tipo III, em relação aos outros grupos. Encontramos também que as fibras colágenas do tipo III em todos os grupos analisados ocupam uma maior área quando comparados com as fibras do tipo I. Os resultados revelam que a coloração de Weigert Oxona, que mostra fibras elásticas, elaunínicas e oxitalânicas, apresentou uma diferença estatisticamente maior de fibras quando comparados com as colorações de Weigert e Verhoeff, que mostra fíbras elaunínicas e elásticas, respectivamente. Os resultados ultra-estruturais demonstraram a presença de muitos fibroblastos e mitocôndrias tanto na paquimeninge como nas leptomeninges dos grupos de ratos neonatos e adultos, indicativo de alta atividade celular e conseqüentemente, intensa formação de tecido conjuntivo. Como as fibras colágenas do tipo III atuam na manutenção da estrutura de tecidos delicados e expansíveis, o estudo mostra que as funções das meninges encefálicas não estão relacionadas apenas com a resistência a trações e tensões a que estão sujeitas o encéfalo. Mas também a função relacionada com a distensibilidade dos vasos meníngeos e cerebrais de acordo com a necessidade do aporte sanguíneo em diversas funções específicas regionais do tecido nervoso.