371 resultados para Trichoptera imaturos
Resumo:
In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This study describes the sperm morphology of the mayfly Hexagenia (Pseudeatonica) albivitta (Ephemeroptera). Its spermatozoon measures approximately 30 μm of which 9 μm corresponds to the head. The head is composed of an approximately round acrosomal vesicle and a cylindrical nucleus. The nucleus has two concavities, one in the anterior tip, where the acrosomal vesicle is inserted and a deeper one at its base, where the flagellum components are inserted. The flagellum is composed of an axoneme, a mitochondrion and a dense rod adjacent to the mitochondrion. A centriolar adjunct is also observed surrounding the axoneme in the initial portion of the flagellum and extends along the flagellum for at least 2 μm, surrounding the axoneme in a half-moon shape. The axoneme is the longest component of the flagellum, and it follows the 9+9+0 pattern, with no central pair of microtubules. At the posterior region of the flagellum, the mitochondrion has a dumb-bell shape in cross sections that, together with the rectangular mitochondrial-associated rod, is responsible for the flattened shape of the flagellum. An internal membrane is observed surrounding both mitochondrion and its associated structure.
Resumo:
Description of the larva and pupal case of Ommatius orenoquensis Bigot (Diptera, Asilidae, Ommatiinae). The last instar larva and the pupal case of Ommatius orenoquensis Bigot, 1896 from a Cerrado (Brazilian Savanna) area in São Paulo, southeastern Brazil, are for the first time described and illustrated.
Resumo:
The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.
Resumo:
The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.
Resumo:
Immatures of Syphrea uberabensis guerini Bechyné (Coleoptera, Chrysomelidae, Alticini). Larva and pupa of Syphrea uberabensis guerini are described and illustrated for the first time and a comparison with the described immatures of other Alticini species from Neotropical region and also with Hermaeophaga mercurialis (Fabricius, 1792), from Palearctic region, is presented. Tibouchina stenocarpa (DC.) Cogn. (Melastomataceae) (quaresmeira-do-cerrado) is registered as a new host plant for this species of Alticini.
Resumo:
Egg cases and larvae of Gratiana conformis (Boheman, 1854) were collected on Solanum paniculatum L. and reared in laboratory. Egg case, egg, third instar and mature larvae and pupa are described and illustrated. Biological notes and a comparison with the immatures of other Gratiana species and Charidotis gemellata Boheman, 1855, are also presented.
Resumo:
Em pesquisa de campo realizada no interior do Estado do Espírito Santo, Brasil, em janeiro de 2006, como parte de projeto sobre a transmissão de Plasmodium, foram coletadas larvas de anofelinos em bromélias. Os imaturos foram mantidos no laboratório até a obtenção dos adultos machos e fêmeas associados com as exúvias das larvas e das pupas, para serem identificados. Conseqüentemente, verificou-se que dois espécimes pertenciam a Anopheles (Kerteszia) homunculus Komp, 1937. Este é o primeiro registro dessa espécie de Kerteszia no Espírito Santo. O encontro evidencia a importância de estudos adicionais de modo a estabelecer a distribuição geográfica do An. homunculus, bem como o status taxonômico e a importância epidemiológica da espécie na dinâmica da transmissão da malária em áreas de Mata Atlântica.
Resumo:
OBJETIVO: Comparar a diversidade da fauna de culicídeos em bromélias de solo segundo ambientes urbano, periurbano e mata primitiva. MÉTODOS: O estudo foi realizado no município de Ilhabela, litoral norte do estado de São Paulo, em tanques de bromélias de ambientes urbano, periurbano e mata. Realizaram-se coletas de imaturos quinzenalmente, de março de 1998 a julho de 1999. A presença e freqüência de espécies nos diferentes ambientes foram comparadas com base em estimativas da diversidade para medir a riqueza, dominância e análise de variância (ANOVA). RESULTADOS: Coletaram-se 31.134 formas imaturas de mosquitos nas bromélias, distribuídas em sete gêneros e 37 espécies. O ambiente urbano registrou maior abundância, 14.575 indivíduos, seguido do periurbano com 10.987, e a mata, com o menor número de exemplares, 5.572. Foram coletadas 30 espécies no habitat urbano, 32 no periurbano e 33 na mata. As espécies dominantes foram Culex (Microculex) pleuristriatus nos ambientes urbano e periurbano, e Culex ocellatus na mata. De acordo com teste ANOVA a freqüência de mosquitos em bromélias não foi diferente entre os ambientes pesquisados (F=0,5564; p=0,5769). A diversidade de espécies na mata foi maior, e semelhante entre periurbano e urbano. CONCLUSÕES: A composição específica de culicídeos em bromélias de solo mostrou-se diversificada, sendo maior naquelas de ambiente de mata. As espécies dominantes foram Cx. (Mcx.) pleuristriatus e Cx. ocellatus.
Resumo:
INTRODUÇÃO: Alterações no ambiente vêm contribuindo com mudanças climáticas, como o aumento do volume de chuvas, que acarreta as inundações. Medidas estão sendo tomadas no enfrentamento das inundações, como a implantação dos reservatórios de contenção de cheias (piscinões). Neste trabalho, foi avaliada a fauna de culicídeos, de importância epidemiológica, nos piscinões Caguaçu e Inhumas. MÉTODOS: Foram realizadas coletas mensais nos piscinões Caguaçu e Inhumas, situados na região leste de São Paulo, de março de 2006 a fevereiro de 2007, empregando-se os métodos de concha entomológica e aspirador. Para análise dos dados, foram realizadas análises estatísticas descritivas e a regressão linear simples. RESULTADOS: Foram coletados 8.917 culicídeos, destacando-se Culex (Culex) quinquefasciatus, que representou 98,9% dos espécimes no Inhumas e 95,2% no Caguaçu. No Caguaçu, a maior frequência de imaturos foi observada no vertedouro (61%) e no Inhumas na canaleta (42,6%). A precipitação prediz 87% da abundância numérica de larvas de terceiro e de quarto estágio no Caguaçu e 60% do número de pupas coletadas. No Inhumas, a precipitação explicou 36% da abundância numérica de larvas e 18% do número de pupas. CONCLUSÕES: Culex quinquefasciatus, vetor de agentes da filariose, arboviroses e fator de incômodo à população, foi a espécie mais frequente nos dois ambientes. Medidas de controle da espécie nos piscinões estudados se fazem necessárias tendo em vista seu potencial epidemiológico.
Resumo:
A composição de Culicidae do lago de Barra Grande, situado entre os municípios de Esmeralda (Rio Grande do Sul) e Anita Garibaldi (Santa Catarina), foi realizada com coletas mensais. Vinte e quatro espécies foram identificadas dentre um total de 1.185 espécimes (74,7% adultos e 25,3% imaturos), sendo Aedes fluviatilis Lutz a espécie mais frequente. Algumas espécies constituem novos registros e são interesse em saúde pública. O fato sugere que mudanças ambientais na área podem alterar a relação entre humanos e mosquitos vetores
Resumo:
Em pesquisa de campo realizada no interior do Estado do Espírito Santo, Brasil, em janeiro de 2006, como parte de projeto sobre a transmissão de Plasmodium, foram coletadas larvas de anofelinos em bromélias. Os imaturos foram mantidos no laboratório até a obtenção dos adultos machos e fêmeas associados com as exúvias das larvas e das pupas, para serem identificados. Conseqüentemente, verificou-se que dois espécimes pertenciam a Anopheles (Kerteszia) homunculus Komp, 1937. Este é o primeiro registro dessa espécie de Kerteszia no Espírito Santo. O encontro evidencia a importância de estudos adicionais de modo a estabelecer a distribuição geográfica do An. homunculus, bem como o status taxonômico e a importância epidemiológica da espécie na dinâmica da transmissão da malária em áreas de Mata Atlântica
Resumo:
The development of biomonitoring programs based on the macroinvertebrate community requires the understanding of species distribution patterns, as well as of the responses of the community to anthropogenic stressors. In this study, 49 metrics were tested as potential means of assessing the condition of 29 first- and second-order streams located in areas of differing types of land use in So Paulo State, Brazil. Of the sampled streams, 15 were in well-preserved regions in the Atlantic Forest, 5 were among sugarcane cultivations, 5 were in areas of pasture, and 4 were among eucalyptus plantations. The metrics were assessed against the following criteria: (1) predictable response to the impact of human activity; (2) highest taxonomic resolution, and (3) operational and theoretical simplicity. We found that 18 metrics were correlated with the environmental and spatial predictors used, and seven of these satisfied the selection criteria and are thus candidates for inclusion in a multimetric system to assess low-order streams in So Paulo State. These metrics are family richness; Ephemeroptera, Plecoptera and Trichoptera (EPT) richness; proportion of Megaloptera and Hirudinea; proportion of EPT; Shannon diversity index for genus; and adapted Biological Monitoring Work Party biotic index.
Resumo:
Evaluation of the aquatic macroinvertebrate community as a tool for monitoring a reservoir in the Pitangui river basin, Parana, Brazil. Benthic and nektonic macroinvertebrates play an important role in the structure and function of aquatic ecosystems and their distribution is influenced by chemical features of the substrate, vegetation composition, and water depth. Knowledge on the fauna contributes to the assessment of water quality and development of biodiversity conservation activities. Different biotic factors affecting the invertebrate community were evaluated in the Alagados reservoir, the main water source of the city of Ponta Grossa, Parana. In five different sampling points, 18,473 specimens of aquatic or semiaquatic macroinvertebrates were collected, belonging to 46 taxa of the phylla Annelida (Hirudinea and Oligochaeta), Mollusca (Gastropoda), Platyhelminthes (Turbellaria), Nematoda and Arthropoda (Arachnida, Crustacea and Insecta). This community was composed mainly of predators (45.7% of the taxa sampled), collectors and/or filterers (23.9%), scrapers (15.2%), shredders (13.0%) and detritivores (2.2%). Diversity (H`) and evenness (J) indices were significantly low for the sites examined, and H` ranged between 0.3301 and 1.0396. Regarding tolerance of organisms to organic pollution, more sensitive taxa were very rare (Plecoptera) or unusual (Trichoptera and Ephemeroptera). Among the more resistant groups are Chironomidae and Hirudinea, both fairly common in the samples. This study corroborates the importance of bioindicators as a tool to assess water quality for human consumption and for the conservation of aquatic environments, integrating physical, chemical and biological factors in monitoring programs.