Pediculose

A relação parasita-hospedeiro entre o piolho e o Homem representa um dos maiores casos de sucesso de ectoparasitoses. Apesar de clinicamente a infestação por piolhos não provocar grandes danos á saúde o impacto social mental e económico é substancial. Não há programas que priorizem o controle de ectoparasitas na saúde. Uma crise emergente no controlo da pediculose, devido à falta de opções de novos pediculicidas, abriu caminho à eventualidade de resistências. A ocorrência de mutações, deve-se em grande parte ao facto do abuso indiscriminado e utilização de produtos que estavam a ser comercializados em ampla escala como Over-the-counter drugs (OTC), particularmente a permetrina e piretroides.

Doença enxerto-versus hospedeiro: determinação da expressão de genes e alterações de vias associadas ao sistema imunológico usando metodos da biofísica

O transplante de medula óssea (TMO) é um procedimento terapêutico importante em casos relacionados à pacientes com leucemia ou linfoma. Em decorrência desse processo, uma reação conhecida como doença enxerto-versus-hospedeiro (GVHD) pode ocorrer em pacientes susceptíveis como conseqüência da presença de células imunocompetentes do doador. Entretanto, não existe um modelo para descrever completamente as ações relacionadas ao mecanismo imunológico da GVHD desde a fase que inicializa a doença até a fase efetora. O Objetivo geral deste estudo é a investigação da resposta imunológica considerando-se o sistema HLA (antígenos leucocitários humano) em pacientes que desenvolveram a GVHD em decorrência do TMO. O National Cancer Institute (NCI) – Pathway interaction Database e Reactome foram usados como bases de dados com o objetivo de se estudar a expressão de genes e vias relacionados às Classes I e II do sistema HLA (antígenos leucocitários humano). O estudo considerou a mudança de expressão de genes relacionados às 17 vias do sistema imunológico com potencialidade para se expressar em pacientes que desenvolveram a GVHD associada à TMO. Dados referentes aos transcriptomas foram obtidos utilizando-se a plataforma GPL570 Affymetrix Genoma Humano U133 Plus. A atividade relativa foi usada para determinar as alterações das vias em amostras de GVHD em relação ao controle. As análises foram realizadas utilizando-se o software Via Complex e Bioconductor. Observou-se aumento significativo da expressão de genes ralacionados às vias do sistema imune adaptativo, antígenos associados às Classe I e II do HLA, fosforilação de CD3 e CD247, sinalização dos receptores de células T em CD4+ nativas e ativação de NF-kapa β nas células B. Também observou-se alterações significativas na mudança de expressão dos genes associados às vias relacionadas à super família de moléculas B7:CD28\CTLA-4 quando comparadas ao controle. Isso pode indicar a necessidade de geração de um segundo sinal co-estimulador em GVHD, acionado pelas moléculas dessa super família. O aumento da expressão do gene CD69 nas amostras experimentais caracteriza a ativação celular e, portanto, a sinalização de estímulos em GVHD. Os achados obtidos neste estudo contribuem para melhor elucidar o mecanismo imunopatogênico associado à GVHD. P

A infecção por Leishmania infantum chagasi altera o metabolismo lipídico do hospedeiro

American visceral leishmaniasis (AVL), caused by Leishmania infantum chagasi (L.i.chagasi), stands as a public health problem in Brazil, with human and canine cases related in all states..Lipid metabolism can be modified in several status of infection. For example, experimental studies show that the cholesterol is necessary to internalization and replication of L.i.chagasi in macrophages through caveolar domains. Patients with AVL present low levels of cholesterol and a visible triglycerides increase. This work aimed to evaluate the lipid metabolism in several post-infection status by L.i.chagasi, including individuals with symptomatic infection (AVL), and asymptomatic. The levels of cholesterol, triglycerides, HDL and reactive C protein, were measured. Individuals with AVL were compared with individuals with assymptomatic infection and presented low levels of total cholesterol (128 ± 6.180 mg/dL vs. 158 ±5.733 mg/dL, p=0.0001), HDL (29 ± 1.746 mg/dL vs. 37 ± 1.647 mg/dL, p=0.0001), increased levels of triglycerides (149.5 mg/dL ± 12.72 vs. 78.00 ± 10.43 mg/dL, p=0.0095) and higher levels of reactive C protein (1.750± 0.4939 mg/dL vs. 0.40 ± 0.1707 mg/dL; p=0.0001). The expression of genes related to lipid metabolism, such as LXR-a, LXR-b, PPAR-a, PPAR-d, PPAR-g and APOE was evaluated by real time PCR. A reduction in the expression of those genes was found in the group of AVL patients corroborating the serum levels of the metabolites earlier quantified. Our findings suggest a modulation of metabolism of lipids, in the chronic phase of AVL, this could facilitate the survival of leishmania, due to the known reduction on the ability of macrophages in presenting antigens efficiently to the T cells due to the reduction in the cholesterol available, it results in a subversion of the host immunity.

Relação da doença periodontal com o cancro do pâncreas: diagnóstico do cancro do pâncreas com recurso a testes salivares

Dissertação para obtenção do grau de Mestre no Instituto Superior de Ciências da Saúde Egas Moniz

Protein disulfide isomerase as a target for besnoitiosis therapy : molecular characterization and studies of its role in infection and host immune response

Tese de Doutoramento em Ciências Veterinárias na especialidade de Sanidade Animal

Medicina de espécies zoológicas

O presente relatório refere-se ao estágio curricular realizado no Badoca Safari Park, no âmbito do mestrado integrado em medicina veterinária da Universidade de Évora, na área de medicina de espécies zoológicas Este encontra-se dividido em duas partes, uma relativa às atividades realizadas e casuística, acompanhada de aprofundamento teórico, e outra relacionada com a pesquisa de hemoparasitas em ungulados, através de esfregaços sanguíneos, efetuada no decorrer do estágio. As hemoparasitoses são infeções com potencial zoonótico, transmitidas por vetores, associadas a importantes perdas económicas. O controlo destas afeções tem como obstáculos fatores económicos e sociais, a heterogenicidade de hospedeiros que estes hemoparasitas e respetivos vetores apresentam, assim como o facto das espécies de animais selvagens poderem atuar como hospedeiros reservatórios. A entrada de animais exóticos e saída de autóctones, em zonas endémicas, provoca desequilíbrios na relação entre o parasita e hospedeiro que poderão despoletar episódios de doença; Abstract: Zoo and Wildlife medicine This report refers to the internship held at Badoca Safari Park, as part of the integrated master’s degree in veterinary medicine, at the University of Évora, in the clinic area of wild species and wild animals. This thesis is devided into two parts, one on the activities and cases, accompanied by theoretical studies, and the other related to hemoparasites research on ungulates through blood smears, performed during the intership. The hemoparasitoses are infections with zoonotic potential, transmited by vectors associated with significant economic losses. The control of these affections has as main obstacles the economic and social factors, the heterogeneity of hosts these hemoparasites and respective vectors present, as well as the fact that the wildlife species can act as reservoir hosts. The entry of exotic animals and the disappearance of natives, in endemic areas, causes imbalances in the relationship between parasite and host that can trigger episodes of illness.

Relação dose-dependente do uso crônico de fenitoína e atrofia cerebelar em pacientes com epilepsia

The chronic treatment with phenytoin or the acute intoxication by this drug may cause permanent cerebellar injury with atrophy of cerebellum vermis and hemispheres, which can be detected by neuroimaging studies. The aim of the present study was to investigate the correlation between the dosage and duration of treatment with phenytoin and the occurrence of cerebellar atrophy. Sixty-six patients were studied and had their tomographies analyzed for cerebellar atrophy. Of the 66 patients studied, 18 had moderate/severe atrophy, 15 had mild atrophy and 33 were considered to be normal. The patients with moderate/severe atrophy were those with higher exposure to phenytoin (longer duration of treatment and higher total dosage) showing statistically significant difference when compared to patients with mild atrophy or without atrophy (p=0.02). Further, the patients with moderate/severe atrophy had serum levels of phenytoin statistically higher than those of patients with mild atrophy or without atrophy (p = 0.008). There was no association between other antiepileptic drugs dosage or duration of treatment and degree of cerebellar atrophy. We also found that older patients had cerebellar atrophy more frequently, indicating that age or duration of the seizure disorder may also be important in the determination of cerebellar degeneration in these patients. We conclude that although there is a possibility that repeated seizures contribute to cerebellar damage, long term exposure to phenytoin, particularly in high doses and toxic serum levels, cause cerebellar atrophy.

Estudo da capacidade de complexação e sua relação com algumas variáveis ambientais em cinco represas do Rio Tietê/Brasil

The copper and cadmium complexation properties in natural sediment suspensions of reservoirs of the Tietê River were studied using the solid membrane copper and cadmium ion-selective electrodes. The complexation and the average conditional stability constants were determined under equilibrium conditions at pH=6.00 ± 0.05 in a medium of 1.0 mol L-1 sodium nitrate, using the Scatchard method. The copper and cadmium electrodes presented Nernstian behavior from 1x10-6 to 1x10-3 mol L-1 of total metal concentration. Scatchard graphs suggest two classes of binding sites for both metals. A multivariate study was done to correlate the reservoirs and the variables: complexation properties, size, total organic carbon, volatile acid sulfide, E II and pH.

Glicoproteína-P, resistência a múltiplas drogas (MDR) e relação estrutura-atividade de moduladores

Multidrug resistance, MDR is a major obstacle for cancer chemotherapy. MDR can be reversed by drugs that vary in their chemical structure and main biological activity. Many efforts have been done to overcome MDR based on studies of structure-activity relationships and in this review we summarize some aspects of MDR mediated by P-glycoprotein (P-gp), as the most experimentally and clinically tested form of drug resistance. The most significant MDR mechanisms revealed until now are shortly discussed. Physicochemical and structural properties of MDR modulators, measures of the MDR reversal, and QSAR studies are included.

PREDIÇÃO DA ATIVIDADE DE ÁGUA E RELAÇÃO ENTRE A ATIVIDADE DE ÁGUA E A DEPRESSÃO DO PONTO DE CONGELAMENTO DE SUCOS DE FRUTAS

This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Realidade da olimpíada colegial do estado de São Paulo (OCESP) em relação ao discurso presente na educação física acerca da competição escolar : estudo da região leste de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física

A reeducação do movimento respiratorio em relação aos dominios psicologicos e motor de idosos

Universidade Estadual de Campinas. Faculdade de Educação Física

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física