998 resultados para Natural fragile
Resumo:
Viruses that establish a persistent infection with their host have evolved numerous strategies to evade the immune system. Consequently, they are useful tools to dissect the complex cellular processes that comprise the immune response. Rapid progress has been made in recent years in defining the role of cellular MHC class I molecules in regulating the response of natural killer (NK) cells. Concomitantly, the roles of the MHC class I homologues encoded by human and mouse cytomegaloviruses in evading or subverting NK cell responses has received considerable interest. This review discusses the results from a number of studies that have pursued the biological function of the viral MHC class I homologues. Based on the evidence from these studies, hypotheses for the possible role of these intriguing molecules are presented. (C) 2000 Editions scientifiques et medicales Elsevier SAS.
Resumo:
Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
Resumo:
The reactivity of sera from patients with cervical cancer with the E7 protein of human papilloma virus type 16 (HPV16) was estimated using a novel non-radioactive immunoprecipitation assay and four established protein-and peptide-based immunoassays. Six of 14 sera from patients with cervical cancer and 1 of 10 sera from healthy laboratory staff showed repeated reactivity with E7 in at least one assay. Four of the 7 reactive sera were consistently reactive in more than one assay, but only one was reactive in all four assays. Following immunization with E7, 2 of 5 patients with cervical cancer had increased E7-specific reactivity, measurable in one or more assays. No single assay was particularly sensitive for E7 reactivity, or predictive of cervical cancer. Mapping of E7 reactivity to specific E7 peptides was unsuccessful, suggesting that natural or induced E7 reactivity in human serum is commonly directed to conformational epitopes of E7, These results suggest that each assay employed with is study measures a different aspect of E7 reactivity, and that various reactivities to E7 may manifest following HPV infection or immunization. This finding is of significance for monitoring of E7 immunotherapy and for serological screening for cervical cancer. Copyright (C) 2000 S.Karger, AG. Basel.
Resumo:
Few studies have demonstrated that innate lymphocytes play a major role in preventing spontaneous tumor formation. We evaluated the development of spontaneous tumors in mice lacking beta-2 microglobulin (beta2m; and thus MHC class I, CD1d, and CD16) and/or perform, since these tumor cells would be expected to activate innate effector cells. Approximately half the cohort of perform gene-targeted mice succumbed to spontaneous disseminated B cell lymphomas and in mice that also lacked beta2m, the lymphomas developed earlier (by more than 100 d) and with greater incidence (84%). B cell lymphomas from perforin/beta2m gene-targeted mice effectively primed cell-mediated cytotoxicity and perform, but not IFN-gamma, IL-12, or IL-18, was absolutely essential for tumor rejection. Activated NK1.1(+) and gammadeltaTCR(+) T cells were abundant at the tumor site, and transplanted tumors were strongly rejected by either, or both, of these cell types. Blockade of a number of different known costimulatory pathways failed to prevent tumor rejection. These results reflect a critical role for NK cells and gammadeltaTCP(+) T cells in innate immune surveillance of B cell lymphomas, mediated by as yet undetermined pathway(s) of tumor recognition.
Resumo:
Stability of matchings was proved to be a new cooperative equilibrium concept in Sotomayor (Dynamics and equilibrium: essays in honor to D. Gale, 1992). That paper introduces the innovation of treating as multi-dimensional the payoff of a player with a quota greater than one. This is done for the many-to-many matching model with additively separable utilities, for which the stability concept is defined. It is then proved, via linear programming, that the set of stable outcomes is nonempty and it may be strictly bigger than the set of dual solutions and strictly smaller than the core. The present paper defines a general concept of stability and shows that this concept is a natural solution concept, stronger than the core concept, for a much more general coalitional game than a matching game. Instead of mutual agreements inside partnerships, the players are allowed to make collective agreements inside coalitions of any size and to distribute his labor among them. A collective agreement determines the level of labor at which the coalition operates and the division, among its members, of the income generated by the coalition. An allocation specifies a set of collective agreements for each player.
Resumo:
In a decentralized setting the game-theoretical predictions are that only strong blockings are allowed to rupture the structure of a matching. This paper argues that, under indifferences, also weak blockings should be considered when these blockings come from the grand coalition. This solution concept requires stability plus Pareto optimality. A characterization of the set of Pareto-stable matchings for the roommate and the marriage models is provided in terms of individually rational matchings whose blocking pairs, if any, are formed with unmatched agents. These matchings always exist and give an economic intuition on how blocking can be done by non-trading agents, so that the transactions need not be undone as agents reach the set of stable matchings. Some properties of the Pareto-stable matchings shared by the Marriage and Roommate models are obtained.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Drosophila antonietae is a cactophilic species that is found in the mesophilic forest of the Parana`-Paraguay river basin and in the dunes of the South Atlantic coast of Brazil. Although the genetic structure of the Parana`-Paraguay river basin populations has already been established, the relationship between these populations and those on the Atlantic coast is controversial. In this study, we compared 33 repetitive units of pBuM-2 satellite DNA isolated from individuals from 8 populations of D. antonietae in these geographic regions, including some populations found within a contact zone with the closely related D. serido. The pBuM-2 sequences showed low interpopulational variability. This result was interpreted as a consequence of both gene flow among the populations and unequal crossing over promoting homogenization of the tandem arrays. The results presented here, together with those of previous studies, highlight the use of pBuM-2 for solving taxonomic conflicts within the D. buzzatii species cluster.
Resumo:
in the Apis mellifera post-genomic era, RNAi protocols have been used in functional approaches. However, sample manipulation and invasive methods such as injection of double-stranded RNA (dsRNA) can compromise physiology and survival. To circumvent these problems, we developed a non-invasive method for honeybee gene knockdown, using a well-established vitellogenin RNAi system as a model. Second instar larvae received dsRNA for vitellogenin (dsVg-RNA) in their natural diet. For exogenous control, larvae received dsRNA for GFP (dsGFP-RNA). Untreated larvae formed another control group. Around 60% of the treated larvae naturally developed until adult emergence when 0.5 mu g of dsVg-RNA or dsGFP-RNA was offered while no larvae that received 3.0 mu g of dsRNA reached pupal stages. Diet dilution did not affect the removal rates. Viability depends not only on the delivered doses but also on the internal conditions of colonies. The weight of treated and untreated groups showed no statistical differences. This showed that RNAi ingestion did not elicit drastic collateral effects. Approximately 90% of vitellogenin transcripts from 7-day-old workers were silenced compared to controls. A large number of samples are handled in a relatively short time and smaller quantities of RNAi molecules are used compared to invasive methods. These advantages culminate in a versatile and a cost-effective approach. (c) 2008 Elsevier Ltd. All rights reserved.
Resumo:
In this Letter we describe a 12% overall yield synthesis of a model for homoallylic oxygenated alpha-methylene-gamma-butyrolactones with relative stereochemistry defined by selective hydrogenation with Rh/Al(2)O(3). The synthesis was realized in 9 steps involving simple reactions. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
In sub-humid South India, recent studies have shown that black soil areas (Vertisols and vertic Intergrades), located on flat valley bottoms, have been rejuvenated through the incision of streambeds, inducing changes in the pedoclimate and soil transformation. Joint pedological, geochemical and geophysical investigations were performed in order to better understand the ongoing processes and their contribution to the chemistry of local rivers. The seasonal rainfall causes cycles of oxidation and reduction in a perched watertable at the base of the black soil, while the reduced solutions are exported through a loamy sand network. This framework favours a ferrolysis process, which causes low base saturation and protonation of clay, leading to the weathering of 2:1 then 1:1 clay minerals. Maximum weathering conditions occur at the very end of the wet season, just before disappearance of the perched watertable. Therefore, the by-products of soil transformation are partially drained off and calcareous nodules, then further downslope, amorphous silica precipitate upon soil dehydration. The ferrolysed area is fringing the drainage system indicating that its development has been induced by the streambed incision. The distribution of (14)C ages of CaCO(3) nodules suggests that the ferrolysis process started during the late Holocene, only about 2 kyr B.P. at the studied site and about 5 kyr B.P. at the watershed outlet. The results of this study are applied to an assessment of the physical erosion rate (4.8x10(-3) m/kyr) since the recent reactivation of the erosion process. (C) 2010 Elsevier B.V. All rights reserved.
Resumo:
As larvae of marine invertebrates age, their response to settlement cues can change. This change can have significant consequences to both the ecology of these organisms, and to their response to antifouling coatings. This study examines how larval age affects the settlement response of larvae to two naturally derived settlement inhibitors, non-polar extracts from the algae Delisea pulchra and Dilophus marginatus, the former of which contains compounds that are in commercial development as antifoulants. Two species of marine invertebrates with non-feeding larvae were investigated: the bryozoans Watersipora subtorquata and Bugula neritina. Larval age strongly affected larval settlement, with older larvae settling at much higher rates than younger larvae. Despite having strong, inhibitory effects on young larvae, the non-polar extracts did not inhibit the settlement of older larvae to the same degree for both species studied. The results show that the effects of ecologically realistic settlement inhibitors are highly dependent on larval age. Given that the age of settling larvae is likely to be variable in the field, such age specific variation in settlement response of larvae may have important consequences for host-epibiont interactions in natural communities.
Resumo:
Background Obesity is related to a higher rate of infections and some types of cancer. Here we analyzed the impact of obesity and weight loss induced by Roux-en-Y gastric bypass (RYGB) on immunological parameters, i.e., cytokine productions and natural killer cell function. Methods We analyzed 28 morbidly obese patients before and 6 months after RYGB. Biochemical parameters were analyzed in plasma. The percent of natural killer (NK) cells, their cytotoxicity, and the production of cytokines by peripheral blood mononuclear cells were analyzed. The percent of NK cells was determined by flow cytometry and cytokine production determined by enzyme-linked immunosorbent assay. NK cytotoxicity was determined by the lactate dehydrogenase release assay. Results The weight loss 6 months following surgery was 35.3 +/- 4.5 kg. RYGB also improves biochemical parameters. No significant difference was found in the percent of NK cells after surgery. We found an increase in the production of interferon-gamma, interleukin (IL)-12 and IL-18, but not in IL-2, 6 months after RYGB. Cytotoxic activity of NK cells was significantly enhanced 6 months after RYGB [17.1 +/- 14.7% before RYGB vs 51.8 +/- 11.3% at 6 months after, at 40: 1 effector to target cell ratio; p<0.001]. We observed significant post-surgical improvement in the cytotoxic activity curve in 22 out of 28 patients (78.6%), irrespective of the target to effector cell ratio. Conclusions The weight loss induced by RYGB modifies the production of cytokines related with NK cell function and improves its activity.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).