1000 resultados para Mistral, Frédéric, 1830-1914 -- Epistolaris
Resumo:
Mode of access: Internet.
Resumo:
"Indications bibliographiques": p.[409]-421.
Resumo:
International audience
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.
Resumo:
Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.
Resumo:
The clash between German Social Democracy--the party, intellectuals and workers--and the German Imperial State was played out in the Freie Volksbahne (Free People's Theatre) founded by intellectuals to energise working class political awareness of drama with a political and social cutting edge. It fell foul of state censorship, lost its bite, yet prospered.