The unique: or biography of many distinguished characters: with fine portraits.

Binding deteriorated. Foxing. Water. Untrimmed.

French portraits;

Mode of access: Internet.

Portraits intimes.

"Index alphabétique des noms cités dans les cinq volumes des Portraits intimes", at end of 5th series.

The royal dukes and princesses of the family of George III. A view of court life and manners for seventy years, 1760-1830.

Mode of access: Internet.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Growth parameters and mortality rate of the Scomber japonicus peruanus (Jordán & Hubb, 1925) along the Peruvian coast, South Pacific

The growth parameters and the mortality rates of the Scomber japonicus peruanus (Chub mackerel) were studied based on monthly data of frequency of fork length classes obtained from commercial landings off the Peruvian coast from 1996 to 1998. The asymptotic body length and growth rate values obtained by the ELEFAN I (Electronic Length Frequency Analysis) ranged from 40.20 cm to 42.20 cm and from 0.38 to 0.39, respectively. The oscillation amplitude was 0.60; the Winter point values varied from 0.50 to 0.60 and the performance index from 2.79 to 2.84. The total mortality rate of the Chub mackerel obtained by the linearized catch curve oscillated between 1.68 and 3.35. The rate of fishing mortality varied from 1.16 to 2.78 and the exploitation rate from 0.68 to 0.84. The annual rate of natural mortality estimated by the Pauly's method ranged from 0.52 to 0.53. The results obtained allow us to conclude that the longevity of the Chub mackerel was slightly over seven years.

The influence of the 1992-1993 el niño on the reproductive biology of Scomber japonicus peruanus (Jordán & Hubb, 1925)

The influence of the 1992-1993 El Niño events on the reproductive behavior of the Scomber japonicus peruanus (Chub mackerel) was studied from samples collected monthly, along the Peruvian coast (3º23'S-14º00'S), from January 1990 to December 1993. The monthly variation of the gonadosomatic index and the frequency of the periods of gonad maturation evidenced that the spawning of the species occurred all year long, being more intense in summer. The values of the gonadosomatic index were higher during the occurrence of the 1992-1993 El Niño, while the body weight and gonad weight decreased. Regarding the condition factor, its values decreased in females over 35 cm in fork length.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Revision of the genus Physoclypeus Hendel, 1907 (Diptera, Lauxaniidae), with description of seven new species

The genus Physoclypeus Hendel, 1907 has its distribution restricted to the Neotropical region. In this study, its species have been redescribed, three new combinations have been proposed, three lectotypes have been designated, seven new species have been described, and an identification key to the species is presented. An updated list of species of Physoclypeus is presented as: P. annulatus Hendel, 1925; P. coquilletti (Hendel, 1908); P. farinosus (Hendel, 1925); P. flavus (Wiedemann, 1830); P. hendeli sp. nov. (Type locality, Jamaica, N. Irish Town); P. lineatus (Williston, 1896) new comb.; P. montanus (Becker, 1919) new comb.; P. plaumanni sp. nov. (Type locality, Brazil, Santa Catarina); P. risaraldensis sp. nov. (Type locality, Colombia, Risaralda); P. saltensis sp. nov. (Type locality, Argentina, Salta); P. scutellatus (Curran, 1926) new comb.; P. unimaculatus sp. nov. (Type locality, Mexico, Vera Cruz); P. vitattus sp. nov. (Type locality, Brazil, Santa Catarina) and P. zebrinus sp. nov. (Type locality, Costa Rica, Limón).

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Entre o matrimônio, a beleza, a moda e esportes : imagens da mulher na Revista Vida Capichaba (1925-1939)

Essa dissertação tem por objetivo de estudo investigar as imagens do feminino presentes na revista Vida Capichaba, periódico de publicação quinzenal que circulou, no Estado do Espírito Santo, entre as décadas de 1920 e 1950. Diante da longevidade do periódico, optamos por concentrar nossos esforços analíticos nas décadas de 1920 e 1930, especificamente entre os anos de 1925 e 1939. Entendemos que o ideal de mulher presente na revista passou pela construção de requisitos morais e uma formação adequada para desempenhar papéis concebidos como naturalmente femininos como o casamento e a maternidade. Além dessa característica, outras práticas se fizeram ainda mais destacadas. A construção da beleza, de um corpo magro e jovem associado à valorização dos esportes e da moda, se tornaram características da nova mulher capixaba. Eficiência e delicadeza, sensualidade e obediência, maternidade e independência, agilidade e elegância, beleza e liberdade. São dualidades como essas, nas quais códigos sociais tradicionais e novos valores culturais se articulam definindo novos modos de ser, que compuseram o quadro de imagens presente na Vida Capichaba.