Modulation of the secretome of hBMSCs by tailoring the macromolecular gradient in hydrogels to generate tissue-to-tissue interfaces

Tissue-to-tissue interfaces are commonly present in all tissues exhibiting structural, biological and chemical gradients serving a wide range of physiological functions. These interfaces are responsible for mediation of load transfer between two adjacent tissues. They are also important structures in sustaining the cellular communications to retain tissueâ s functional integration and homeostasis. [1] All cells have the capacity to sense and respond to physical and chemical stimulus and when cultured in three-dimensional (3D) environments they tend to perform their function better than in two-dimensional (2D) environments. Spatial and temporal 3D gradient hydrogels better resemble the natural environment of cells in mimicking their extracellular matrix. [2] In this study we hypothesize that differential functional properties can be engineered by modulation of macromolecule gradients in a cell seeded threedimensional hydrogel system. Specifically, differential paracrine secretory profiles can be engineered using human Bone Marrow Stem Cells (hBMSCâ s). Hence, the specific objectives of this study are to: assemble the macromolecular gradient hydrogels to evaluate the suitablity for hBMSCâ s encapsulation by cellular viability and biofunctionality by assessing the paracrine secretion of hBMSCâ s over time. The gradient hydrogels solutions were prepared by blend of macromolecules in one solution such as hyaluronic (HA) acid and collagen (Col) at different ratios. The gradient hydrogels were fabricated into cylindrical silicon moulds with higher ratio solutions assembled at the bottom of the mould and adding the two solutions consecutively on top of each other. The labelling of the macromolecules was performed to confirm the gradient through fluorescence microscopy. Additionally, AFM was conducted to assess the gradient hydrogels stiffness. Gradient hydrogels characterization was performed by HA and Col degradation assay, degree of crosslinking and stability. hBMSCâ s at P3 were encapsulated into each batch solution at 106 cells/ml solution and gradient hydrogels were produced as previously described. The hBMSCâ s were observed under confocal microscopy to assess viability by Live/Dead® staining. Cellular behaviour concerning proliferation and matrix deposition was also performed. Secretory cytokine measurement for pro-inflammatory and angiogenesis factors was carried out using ELISA. At genomic level, qPCR was carried out. The 3D gradient hydrogels platform made of different macromolecules showed to be a suitable environment for hBMSCâ s. The hBMSCâ s gradient hydrogels supported high cell survival and exhibited biofunctionality. Besides, the 3D gradient hydrogels demonstrated differentially secretion of pro-inflammatory and angiogenic factors by the encapsulated hBMSCâ s. References: 1. Mikos, AG. et al., Engineering complex tissues. Tissue Engineering 12,3307, 2006 2. Phillips, JE. et al., Proc Natl Acad Sci USA, 26:12170-5, 2008

Human umbilical cord blood cells in infarcted rats

Therapy with bone marrow-derived cells has been used in ischemic patients with reported success. The aim of this study was to determine the therapeutic efficacy of fresh and frozen human umbilical cord blood cells (hUCB) in Wistar rats submitted to permanent occlusion of the left coronary artery. Three hours after myocardial infarction, 2 x 10(7) hUCB cells or vehicle were administered by intramyocardial injection. The animals were divided into five groups: control (N = 10), sham operated (N = 10), infarcted that received vehicle (N = 9), infarcted treated with cryopreserved hUCB (N = 7), and infarcted treated with fresh hUCB (N = 5). Cardiac function was evaluated by electrocardiogram (ECG) and echocardiogram (ECHO) before cell therapy, and by ECG, ECHO, cardiopulmonary test, and left ventricular pressure measurements 3 weeks later. After 3 weeks, both groups treated with hUCB still had Q wave present in L1, âQRS >90° and reduced shortening fraction (less than 50%). In addition, cardiac indexes of left ventricular contractility and relaxation were 5484 ± 875 and -4032 ± 643 mmHg (cryopreserved hUCB) and 4585 ± 955 and -2862 ± 590 mmHg (fresh hUCB), respectively. These values were not statistically different from those of saline-treated animals. Cardiopulmonary exercise test profile was typical of infarcted hearts; exercise time was about 14 min and maximal VO2 was 24.77 ± 5.00 mL·kg-1·min-1. These data show that hUCB therapy did not improve the cardiac function of infarcted animals or prevent cardiac remodeling.

Chlorella vulgaris up-modulation of myelossupression induced by lead: The role of stromal cells

In this study, Chlorella vulgaris (CV) was examined for its chelating effects on the ability of bone marrow stromal cell layer to display myeloid progenitor cells in vitro in lead-exposed mice, using the long-term bone marrow culture (LTBMC). In addition, the levels of interleukin (IL)-6, an important hematopoietic stimulator, as well as the numbers of adherent and non-adherent cells were also investigated. Mice were gavage treated daily with a single 50 mg/kg dose of CV for 10 days, concomitant to continuous offering of 1300 ppm lead acetate in drinking water. We found that CV up-modulates the reduced ability of stromal cell layer to display myeloid progenitor cells in vitro in lead-exposed mice and restores both the reduced number of non-adherent cells and the ability of stromal cells from these mice to produce IL-6. Monitoring of lead poisoning demonstrated that CV treatment significantly reduced lead levels in blood and tissues, completely restored the normal hepatic ALA levels, decreased the abnormally high plasma ALA and partly recovered the liver capacity to produce porphyrins. These findings provide evidence for a beneficial use of CV for combination or alternative chelating therapy to protect the host from the damage induced by lead poisoning. (C) 2008 Elsevier Ltd. All rights reserved.

Bone marrow cells of swine: collection and separation

Bone marrow is a source of stem cells for greater and easier access, which is widely studied as a provider of hematopoietic and mesenchymal cells for various purposes, mainly therapeutic by the advances in research involving cell therapy. The swine is an animal species commonly used in the pursuit of development of experimental models. Thus, this study aimed to standardize protocol for collection and separation of bone marrow in swines, since this species is widely used as experimental models for various diseases. Twelve animals were used, which underwent bone marrow puncture with access from the iliac crest and cell separation by density gradient followed by a viability test with an average of 98% of viable cells. Given our results, we can ensure the swine as an excellent model for obtaining and isolation of mononuclear cells from bone marrow, stimulating several studies addressing the field of cell therapy. Microsc. Res. Tech., 2012. (C) 2012 Wiley Periodicals, Inc.

Human Adipose-Derived Mesenchymal Stromal Cells Injected Systemically Into GRMD Dogs Without Immunosuppression Are Able to Reach the Host Muscle and Express Human Dystrophin

Duchenne muscular dystrophy (DMD), a lethal X-linked disorder, is the most common and severe form of muscular dystrophies, affecting I in 3,500 male births. Mutations in the DMD gene lead to the absence of muscle dystrophin and a progressive degeneration of skeletal muscle. The possibility to treat DMD through cell therapy has been widely investigated. We have previously shown that human adipose-derived stromal cells (hASCs) injected systemically in SJL mice are able to reach and engraft in the host muscle, express human muscle proteins, and ameliorate the functional performance of injected animals without any immunosuppression. However, before starting clinical trials in humans many questions still need to be addressed in preclinical studies, in particular in larger animal models, when available. The best animal model to address these questions is the golden retriever muscular dystrophy (GRMD) dog that reproduces the full spectrum of human DMD. Affected animals carry a mutation that predicts a premature termination codon in exon 8 and a peptide that is 5% the size of normal dystrophin. These dogs present clinical signs within the first weeks and most of them do not survive beyond age two. Here we show the results of local and intravenous injections of hASCs into GRMD dogs, without immunosuppression. We observed that hASCs injected systemically into the dog cephalic vein are able to reach, engraft, and express human dystrophin in the host GRMD dystrophic muscle up to 6 months after transplantation. Most importantly, we demonstrated that injecting a huge quantity of human mesenchymal cells in a large-animal model, without immunosuppression, is a safe procedure, which may have important applications for future therapy in patients with different forms of muscular dystrophies.

SerpinB1 protects the mature neutrophil reserve in the bone marrow

SerpinB1 is among the most efficient inhibitors of neutrophil serine proteases--NE, CG, and PR-3--and we investigated here its role in neutrophil development and homeostasis. We found that serpinB1 is expressed in all human bone marrow leukocytes, including stem and progenitor cells. Expression levels were highest in the neutrophil lineage and peaked at the promyelocyte stage, coincident with the production and packaging of the target proteases. Neutrophil numbers were decreased substantially in the bone marrow of serpinB1(-/-) mice. This cellular deficit was associated with an increase in serum G-CSF levels. On induction of acute pulmonary injury, neutrophils were recruited to the lungs, causing the bone marrow reserve pool to be completely exhausted in serpinB1(-/-) mice. Numbers of myeloid progenitors were normal in serpinB1(-/-) bone marrow, coincident with the absence of target protease expression at these developmental stages. Maturation arrest of serpinB1(-/-) neutrophils was excluded by the normal CFU-G growth in vitro and the normal expression in mature neutrophils of early and late differentiation markers. Normal absolute numbers of proliferating neutrophils and pulse-chase kinetic studies in vivo showed that the bone marrow deficit in serpinB1(-/-) mice was largely restricted to mature, postmitotic neutrophils. Finally, upon overnight culture, apoptosis and necrosis were greater in purified bone marrow neutrophils from serpinB1(-/-) compared with WT mice. Collectively, these findings demonstrate that serpinB1 sustains a healthy neutrophil reserve that is required in acute immune responses.

Comparative analysis of canine monocyte- and bone-marrow-derived dendritic cells

Dendritic cells (DC) represent a heterogeneous cell family of major importance for innate immune responses against pathogens and antigen presentation during infection, cancer, allergy and autoimmunity. The aim of the present study was to characterize canine DC generated in vitro with respect to their phenotype, responsiveness to toll-like receptor (TLR) ligands and T-cell stimulatory capacity. DC were derived from monocytes (MoDC) and from bone marrow hematopoietic cells cultured with either Flt3-ligand (FL-BMDC) or with GM-CSF (GM-BMDC). All three methods generated cells with typical DC morphology that expressed CD1c, CD11c and CD14, similar to macrophages. However, CD40 was only found on DC, CD206 on MPhi and BMDC, but not on monocytes and MoDC. CD1c was not found on monocytes but on all in vitro differentiated cells. FL-BMDC and GM-BMDC were partially positive for CD4 and CD8. CD45RA was expressed on a subset of FL-BMDC but not on MoDC and GM-BMDC. MoDC and FL-DC responded well to TLR ligands including poly-IC (TLR2), Pam3Cys (TLR3), LPS (TLR4) and imiquimod (TLR7) by up-regulating MHC II and CD86. The generated DC and MPhi showed a stimulatory capacity for lymphocytes, which increased upon maturation with LPS. Taken together, our results are the basis for further characterization of canine DC subsets with respect to their role in inflammation and immune responses.

Multiparameter flow cytometry characterization of MHC class I negative mouse bone marrow cells

BACKGROUND: MHC-I down-regulation was described in foetal liver progenitors, and two different subsets of adult bone marrow derived stem cells. These cells, namely, MHC-I-/Thy1+ bone marrow derived liver stem cells (BMDLSC) and the multipotent adult progenitors (MAPC) differentiated into functioning hepatocytes. The aim of this paper was to characterize the MHC-I negative bone marrow compartment as it pertains to BMDLSC and MAPC. MATERIAL/METHODS: We performed multiparameter flow-cytometry analyses of the MHC-I negative compartment using hematopoietic (CD45, Ter119), and stem cell markers (Thy1.2, c-Kit, IL-3R, CD34) in adult mice. RESULTS: When analysing CD45 and Ter119 expression, the MHC-I negative bone marrow compartment divides into four sub-populations: 1. CD45-/Ter119+: 86.0+/-4.4%; 2. CD45+/Ter119+: 0.2+/-0.1%; 3. CD45+/Ter119-: 11.6+/-3.0%; 4. CD45-/Ter119-: 2.0+/-2.1%. Stem cells markers were only expressed on MHC-I negative/ CD45+/Ter119- cells. In vivo, MAPC (Ter119-/CD45- cells) are composed of MHC-I negative (24%) and MHC-I positive cells and do not express any of the stem cell markers tested. CONCLUSIONS: In conclusion, mouse BMDLSC and MAPC are two distinct stem cell populations. Down-regulation of MHC-I was the only common characteristic found between BMDLSC and MAPC suggesting that selection of MHC-I negative cells might represent an efficient strategy to enrich for bone marrow stem cells with liver developmental potential.

Bone morphogenetic protein 2 incorporated into biomimetic coatings retains its biological activity

We have previously shown that proteins can be incorporated into the latticework of calcium phosphate layers when biomimetically coprecipitated with the inorganic components, upon the surfaces of titanium-alloy implants. In the present study, we wished to ascertain whether recombinant human bone morphogenetic protein 2 (rhBMP-2) thus incorporated retained its bioactivity as an osteoinductive agent. Titanium alloy implants were coated biomimetically with a layer of calcium phosphate in the presence of different concentrations of rhBMP-2 (0.1-10 microg/mL). rhBMP-2 was successfully incorporated into the crystal latticework, as revealed by protein blot staining. rhBMP-2 was taken up by the calcium phosphate coatings in a dose-dependent manner, as determined by ELISA. Rat bone marrow stromal cells were grown directly on these coatings for 8 days. Their osteogenicity was then assessed quantitatively by monitoring alkaline phosphatase activity. This parameter increased as a function of rhBMP-2 concentrations within the coating medium. rhBMP-2 incorporated into calcium phosphate coatings was more potent in stimulating the alkaline phosphatase activity of the adhering cell layer than was the freely suspended drug in stimulating that of cell layers grown on a plastic substratum. This system may be of osteoinductive value in orthopedic and dental implant surgery.

Culture of ovine bone marrow-derived macrophages and evidence for serum factors distinct from M-CSF contributing to their propagation in vitro.

An in vitro system allowing the culture of ovine bone marrow-derived macrophages (BMMs) is described. Bone marrow (BM) cells from the sternum of 4- to 9-month-old sheep were cultured in liquid suspension in hydrophobic bags with medium containing 20% autologous serum and 20% fetal calf serum (FCS). Cells with macrophage characteristics were positively selected and increased four- to five-fold between day (d) 0 and d18. Granulocytes and cells of lymphoid appearance including progenitor cells were negatively selected and were diminished 50-fold during this 18-d culture. The addition of macrophage colony-stimulating factor (M-CSF)-containing supernatants to liquid cultures did not significantly improve the yield of BMM in 18-d cultures. In contrast, cell survival at d6 and macrophage cell yield at d18 depended on the concentration and source of serum in the culture medium. FCS and 1:1 mixtures of FCS and autologous serum were superior to autologous serum alone. Analysis of growth requirements of ovine BMMs suggested that they are under more complex growth control than their murine counterparts. In an [3H]thymidine incorporation assay with BM cells collected at different times of culture, d3 or d4 BM cells responded to human recombinant M-CSF, human recombinant granulocyte-macrophage colony-stimulating factor (GM-CSF), bovine GM-CSF, murine M-CSF or murine M-CSF-containing supernatants, and bovine interleukin 1 beta (IL-1 beta) in decreasing order of magnitude. Likewise, pure murine BMM populations harvested at d6 responded to homologous GM-CSF, IL-3, and human or murine M-CSF. FCS did not stimulate the proliferation of murine BMMs (d6) and of ovine BM cells (d3 or d4). In contrast, ovine BM cells harvested at d12 responded to FCS by proliferation in a dose-dependent manner but failed to proliferate in the presence of human or murine M-CSF or M-CSF-containing supernatants of mouse and sheep fibroblasts containing mouse macrophage growth-promoting activity. Likewise, various cytokine-containing supernatants and recombinant cytokines (murine IL-3, murine and human GM-CSF, murine and bovine IL-1 beta) did not promote proliferation of ovine d12 BM cells to an extent greater than that achieved with 15% FCS alone. Thus, ovine BMM proliferation is under the control of at least two factors acting in sequence, M-CSF and an unidentified factor contained in FCS. The ovine BMM culture system may provide a model for the analysis of myelomonocytopoiesis in vitro.

Increasing DNA repair methyltransferase levels via bone marrow stem cell transduction rescues mice from the toxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea, a chemotherapeutic alkylating agent.

The chloroethylnitrosourea (CNU) alkylating agents are commonly used for cancer chemotherapy, but their usefulness is limited by severe bone marrow toxicity that causes the cumulative depletion of all hematopoietic lineages (pancytopenia). Bone marrow CNU sensitivity is probably due to the inefficient repair of CNU-induced DNA damage; relative to other tissues, bone marrow cells express extremely low levels of the O6-methylguanine DNA methyltransferase (MGMT) protein that repairs cytotoxic O6-chloroethylguanine DNA lesions. Using a simplified recombinant retroviral vector expressing the human MGMT gene under control of the phosphoglycerate kinase promoter (PGK-MGMT) we increased the capacity of murine bone marrow-derived cells to repair CNU-induced DNA damage. Stable reconstitution of mouse bone marrow with genetically modified, MGMT-expressing hematopoietic stem cells conferred considerable resistance to the cytotoxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), a CNU commonly used for chemotherapy. Bone marrow harvested from mice transplanted with PGK-MGMT-transduced cells showed extensive in vitro BCNU resistance. Moreover, MGMT expression in mouse bone marrow conferred in vivo resistance to BCNU-induced pancytopenia and significantly reduced BCNU-induced mortality due to bone marrow hypoplasia. These data demonstrate that increased DNA alkylation repair in primitive hematopoietic stem cells confers multilineage protection from the myelosuppressive effects of BCNU and suggest a possible approach to protecting cancer patients from CNU chemotherapy-related toxicity.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Long-term Spinal Ventral Root Reimplantation, But Not Bone Marrow Mononuclear Cell Treatment, Positively Influences Ultrastructural Synapse Recovery And Motor Axonal Regrowth.

We recently proposed a new surgical approach to treat ventral root avulsion, resulting in motoneuron protection. The present work combined such a surgical approach with bone marrow mononuclear cells (MC) therapy. Therefore, MC were added to the site of reimplantation. Female Lewis rats (seven weeks old) were subjected to unilateral ventral root avulsion (VRA) at L4, L5 and L6 levels and divided into the following groups (n = 5 for each group): Avulsion, sealant reimplanted roots and sealant reimplanted roots plus MC. After four weeks and 12 weeks post-surgery, the lumbar intumescences were processed by transmission electron microscopy, to analyze synaptic inputs to the repaired α motoneurons. Also, the ipsi and contralateral sciatic nerves were processed for axon counting and morphometry. The ultrastructural results indicated a significant preservation of inhibitory pre-synaptic boutons in the groups repaired with sealant alone and associated with MC therapy. Moreover, the average number of axons was higher in treated groups when compared to avulsion only. Complementary to the fiber counting, the morphometric analysis of axonal diameter and g ratio demonstrated that root reimplantation improved the motor component recovery. In conclusion, the data herein demonstrate that root reimplantation at the lesion site may be considered a therapeutic approach, following proximal lesions in the interface of central nervous system (CNS) and peripheral nervous system (PNS), and that MC therapy does not further improve the regenerative recovery, up to 12 weeks post lesion.

Seeding Osteoblastic Cells into a Macroporous Biodegradable CaP/PLGA Scaffold by a Centrifugal Force

This study aims to construct a hybrid biomaterial by seeding osteoblastic cells into a CaP/PLGA scaffold by a centrifugal force. Constructs are evaluated with respect to potential application in bone tissue engineering. Cells adher, spread, and form a layer of tissue lining the scaffold and are capable of migrating, proliferating, and producing mineralized matrix. We have demonstrated that the centrifugal force is highly efficient for constructing a hybrid biomaterial, which acts similarly to bone explants in a cell culture environment. In this way, these constructs could mimic an autogenous bone graft in clinical circumstances. Such a strategy may be useful for bone tissue engineering.

A randomized double-blind control study of early intra-coronary autologous bone marrow cell infusion in acute myocardial infarction: the REGENERATE-AMI clinical trial?.

AIMS: Clinical trials suggest that intracoronary delivery of autologous bone marrow-derived cells (BMCs) 1-7 days post-acute myocardial infarction (AMI) may improve left ventricular (LV) function. Earlier time points have not been evaluated. We sought to determine the effect of intracoronary autologous BMC on LV function when delivered within 24 h of successful reperfusion therapy. METHODS AND RESULTS: A multi-centre phase II randomized, double-blind, and placebo-controlled trial. One hundred patients with anterior AMI and significant regional wall motion abnormality were randomized to receive either intracoronary infusion of BMC or placebo (1:1) within 24 h of successful primary percutaneous intervention (PPCI). The primary endpoint was the change in left ventricular ejection fraction (LVEF) between baseline and 1 year as determined by advanced cardiac imaging. At 1 year, although LVEF increased compared with baseline in both groups, the between-group difference favouring BMC was small (2.2%; 95% confidence interval, CI: -0.5 to 5.0; P = 0.10). However, there was a significantly greater myocardial salvage index in the BMC-treated group compared with placebo (0.1%; 95% CI: 0.0-0.20; P = 0.048). Major adverse events were rare in both treatment groups. CONCLUSION: The early infusion of intracoronary BMC following PPCI for patients with AMI and regional wall motion abnormality leads to a small non-significant improvement in LVEF when compared with placebo; however, it may play an important role in infarct remodelling and myocardial salvage. CLINICAL TRIAL REGISTRATION: Clinicaltrials.gov NCT00765453 and EudraCT 2007-002144-16.