994 resultados para bagasse of cashew
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.
Resumo:
The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.
Resumo:
Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.