Evaluation Of Red Cell And Reticulocyte Parameters As Indicative Of Iron Deficiency In Patients With Anemia Of Chronic Disease.

The purpose of this study was to evaluate the effectiveness of mature red cell and reticulocyte parameters under three conditions: iron deficiency anemia, anemia of chronic disease, and anemia of chronic disease associated with absolute iron deficiency. Peripheral blood cells from 117 adult patients with anemia were classified according to iron status, and inflammatory activity, and the results of a hemoglobinopathy investigation as: iron deficiency anemia (n=42), anemia of chronic disease (n=28), anemia of chronic disease associated with iron deficiency anemia (n=22), and heterozygous β thalassemia (n=25). The percentage of microcytic red cells, hypochromic red cells, and levels of hemoglobin content in both reticulocytes and mature red cells were determined. Receiver operating characteristic analysis was used to evaluate the accuracy of the parameters in differentiating between the different types of anemia. There was no significant difference between the iron deficient group and anemia of chronic disease associated with absolute iron deficiency in respect to any parameter. The percentage of hypochromic red cells was the best parameter to discriminate anemia of chronic disease with and without absolute iron deficiency (area under curve=0.785; 95% confidence interval: 0.661-0.909, with sensitivity of 72.7%, and specificity of 70.4%; cut-off value 1.8%). The formula microcytic red cells minus hypochromic red cells was very accurate in differentiating iron deficiency anemia and heterozygous β thalassemia (area under curve=0.977; 95% confidence interval: 0.950-1.005; with sensitivity of 96.2%, and specificity of 92.7%; cut-off value 13.8). The indices related to red cells and reticulocytes have a moderate performance in identifying absolute iron deficiency in patients with anemia of chronic disease.

Myelodysplastic Syndrome With Synchronous Gastric Cancer: When The Symptoms Suggest Something Else.

Although myelodysplastic syndromes have a clear definition in theory, the morphologic dysplasia associated with ineffective hematopoiesis may be subtle and difficult to recognize and can commonly be mimicked by systemic conditions, such as infections, autoimmune disorders, nutritional deficiencies, toxic factors and non-hematological malignancies. However, myelodysplastic syndromes may truly coexist with other systemic diseases, which can be masked when the patient's symptoms are attributed exclusively to myelodysplastic syndromes without further investigation. To better illustrate this, we herein describe two cases associated with synchronous gastric cancers.

Motivating Medical Students To Learn Basic Science Concepts Using Chronic Myeloid Leukemia As An Integration Theme.

To report on the use of chronic myeloid leukemia as a theme of basic clinical integration for first year medical students to motivate and enable in-depth understanding of the basic sciences of the future physician. During the past thirteen years we have reviewed and updated the curriculum of the medical school of the Universidade Estadual de Campinas. The main objective of the new curriculum is to teach the students how to learn to learn. Since then, a case of chronic myeloid leukemia has been introduced to first year medical students and discussed in horizontal integration with all themes taught during a molecular and cell biology course. Cell structure and components, protein, chromosomes, gene organization, proliferation, cell cycle, apoptosis, signaling and so on are all themes approached during this course. At the end of every topic approached, the students prepare in advance the corresponding topic of clinical cases chosen randomly during the class, which are then presented by them. During the final class, a paper regarding mutations in the abl gene that cause resistance to tyrosine kinase inhibitors is discussed. After each class, three tests are solved in an interactive evaluation. The course has been successful since its beginning, 13 years ago. Great motivation of those who participated in the course was observed. There were less than 20% absences in the classes. At least three (and as many as nine) students every year were interested in starting research training in the field of hematology. At the end of each class, an interactive evaluation was performed and more than 70% of the answers were correct in each evaluation. Moreover, for the final evaluation, the students summarized, in a written report, the molecular and therapeutic basis of chronic myeloid leukemia, with scores ranging from 0 to 10. Considering all 13 years, a median of 78% of the class scored above 5 (min 74%-max 85%), and a median of 67% scored above 7. Chronic myeloid leukemia is an excellent example of a disease that can be used for clinical basic integration as this disorder involves well known protein, cytogenetic and cell function abnormalities, has well-defined diagnostic strategies and a target oriented therapy.

Lingüística textual: quo vadis?

This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Medida da capacidade antioxidante de fluidos biologicos por voltametria de pulso diferencial associada ao uso de surfactante como resposta as adaptações geradas pelo exercicio

Universidade Estadual de Campinas . Faculdade de Educação Física

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física