Effects of diphosphine structure on aurophilicity and luminescence in Au(I) complexes

The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Equilibrium structure of erbium-oxygen complexes in crystalline silicon

The equilibrium structure of ErOn (nless than or equal to6) complexes in crystalline silicon has been investigated by density-functional computations. Two different geometries have been considered, corresponding to the substitutional and tetrahedral interstitial site for erbium. All atomic coordinates have been optimized by Car-Parrinello molecular dynamics. The resulting structures have low symmetry, with E-O distances of similar to2.35 Angstrom. The substitutional site is the most stable one for nless than or equal to2, while the tetrahedral interstitial is favored for n>2.

Synthesis of Piano Stool Complexes Employing the Pentafluorophenyl Substituted Diphosphine (C6F5)2PCH2P(C6F5)2 and the Effect of Phosphine Modifiers on Hydrogen Transfer Catalysis.

Ruthenium, rhodium, and iridium piano stool complexes of the pentafluorophenyl-substituted diphosphine (C6F5)2PCH2P(C6F5)2 (2) have been prepared and structurally characterized by single-crystal X-ray diffraction. The Cp-P tethered complex [{(C5Me4CH2C6F4(C6F5)CH2P(C6F5)2}RhCl2] (9), in which only one phosphorus is coordinated to the rhodium, was prepared by thermolysis of a slurry of [Cp*RhCl(-Cl)]2 and 2 and was structurally characterized by single-crystal X-ray diffraction. The tethering occurs by intramolecular dehydrofluorinative coupling of the pentamethylcyclopentadienyl ligand and P,P-coordinated 2. The geometric changes that occur on tethering force dissociation of one of the phosphorus atoms. The effects of introducing phosphine ligands to the coordination sphere of piano stool hydrogen transfer catalysts have been studied. The complexes of fluorinated phosphine complexes are found to transfer hydrogen at rates that compare favorably with leading catalysts, particularly when the phosphine and cyclopentadienyl functionalities are tethered. The highly chelating Cp-PP complex [(C5Me4CH2-2-C5F3N-4-PPhCH2CH2PPh2)RhCl]BF4 (1) was found to outperform all other complexes tested. The mechanism of hydrogen transfer catalyzed by piano stool phosphine complexes is discussed with reference to the trends in activity observed.

Base free dynamic kinetic resolution of secondary alcohols using ‘piano stool’ complexes of N-heterocyclic carbenes

Piano stool complexes of rhodium and iridium activated by fluorinated and non-fluorinated N-heterocyclic carbene (NHC) ligands were shown to be catalysts for racemization in the one-pot chemoenzymic dynamic kinetic resolution (DKR) of secondary alcohols. Excellent conversions and good enantioselectivities were observed for alkyl aryl and dialkyl secondary alcohols.