1000 resultados para Fases da germinação


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Swine production represents an important segment of Brazilian economy, and the possibility of increasing production is eminent mainly if considered the low pork consumption when compared to other meat and the consumption of other countries. The increasing need in the international market demands show that in a near future the commercial barriers will be based on welfare, in the protection of the environment as well as in the worker's legislation. Little knowledge is available in the subject of worker's standards in the environmental agents in rural activities as well as the air quality under Brazilian conditions. The objectives of this research were to apply the main used standards related to noise and gases and to estimate occupational risk using measurements of noise level, hydrogen sulfide, methane and oxygen in swine housing, in piglet's nursery and finishing. The results showed that the continuous noise level were below the one found in the standards, however there were observed differences (P < 0.05) in relation to the noise level measured in piglet's nursing cages and in semi-slatted floor. The respective concentrations of hydrogen sulfide and methane were less than 1 ppm and less than 0,1% by volume, which was lower than the recommended limits in NR-15, CIGR and ACGIH. The oxygen level was 21% in average.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The use of technology to protect and produce vegetables and ornamental plants was developed over several adaptation phases that supported the demand for quality and amount of products. These developments also reduced production costs and climate damage to the crops. Many of these adaptations were carried out by farmers on their own initiative, using different materials and devices to solve their problems. This study was carried out at Agricultural Engineering College - Campinas University/UNICAMP, from December 2002 to January 2003, with the objective of evaluating the deformations of the constructive system of bamboo structure for greenhouses, submitted to different spacing among columns, and different vertical strains. It was tested the use of beams and columns built with bamboo stems from the specie Bambusa tuldoides Munro. The beams and columns were tied together with plastic spacing parts, specially designed to facilitate and standardize the construction of the building, providing more resistance and stability. Three column spaces (2.0, 2.5 and 3.0 m) were evaluated under different load strains. The best result was obtained with a spacing of 2.5 m.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We studied the feeding behavior of bats and their role in the seed dispersal of Vismia cayennensis in Manaus region, Amazonas State, northern Brazil. The characteristics of the plant and its fruits fit the chiropterocory syndrome. Five species of phyllostomid bats fed on Vismia fruits: Sturnira lilium, Sturnira tildae, Artibeus concolor, Carollia perspicillata and Rhinophylla pumilio. Apparently there is a relationship between flock foraging behavior and fruit availability in early night. The feeding behavior was similar for all bat species, varying with the presentation mode of the fruits. Seed germination tests and the distributional patterns of the plants indicate that bats are the dispersers of V. cayennensis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article presents a characterization of the lexical competence (vocabulary knowledge and use) of students learning to read in EFL in a public university in São Paulo state. Although vocabulary has been consistently cited as one of the EFL reader´s main source of difficulty, there is no data in the literature which shows the extent of the difficulties. The data for this study is part of a previous research, which investigates, from the perspective of an interactive model of reading, the relationship between lexical competence and EFL reading comprehension. Quantitative as well as qualitative data was considered. For this study, the quantitative data is the product of vocabulary tests of 49 subjects while the qualitative data comprises pause protocols of three subjects, with levels of reading ability ranging from good to poor, selected upon their performance in the quantitative study. A rich concept of vocabulary knowledge was adapted and used for the development of vocabulary tests and analysis of protocols. The results on both studies show, with a few exceptions, the lexical competence of the group to be vague and imprecise in two dimensions: quantitative (number of known words or vocabulary size) and qualitative (depth or width of this knowledge). Implications for the teaching of reading in a foreign context are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The spouted and fluidized bed technologies are usually employed in operations of drying, coating and granulation of particles by the chemical and pharmaceutical industries. The use of these techniques in agronomy is limited to the treatment of some species of seeds. In this work, the objective was to analyse the fluid-dynamics of fluidized and spouted beds when broccoli (Brassica oleracea L. var. Italica) seeds are used and also to verify the influence on seed germination after 60 min of seed exposition to spouting or fluidization, at room temperature. The fluid-dynamics was defined by the measurements of the bed pressure drop as a function of the air flow rate for different seeds loads. The experimental conditions were based on the physical properties of the seeds and were limited by the apparatus dimensions. The cone-cylindrical bed was constructed in plexyglass to permit flow visualization. The values of the parameters: maximum pressure drop, minimum spouting flow rate and pressure drop, and stable spout pressure drop were experimentally obtained from the fluid-dynamic analysis and were compared with the values calculated by empirical equations found in the literature. The same procedure was carried out with the fluidized bed and the important parameters for this regime were the air velocity and the bed pressure drop at minimum fluidization. The analysis of seed germination indicated that no damage was caused to the seeds by the spout or fluidization processes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.