Perfil sensorial de ovos de Páscoa

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação da eficácia da ropivacaína 1% quando associada ou não à hialuronidase na anestesia peribulbar para cirurgia de catarata

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida e nivel de atividade fisica de funcionarios de empresa de tecnologia da comunicação

Universidade Estadual de Campinas . Faculdade de Educação Física

Cultura de movimento e identidade : a Educação Fisica na contemporaneidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Autoconceito e capacidades fisicas de idosos depessivos e não depressivos participantes de um programa de atividade fisica de longa duração

Universidade Estadual de Campinas . Faculdade de Educação Física

A Educação Fisica e o discurso midiatico : abordagem critico-emancipatoria em pesquisa-ação no ensino de graduação. Subsidios para a saude?

Universidade Estadual de Campinas . Faculdade de Educação Física

Avaliação e intervenção socio-neuromotora de crianças com marasmo na primeira infancia

Universidade Estadual de Campinas . Faculdade de Educação Física