A metalinguagem como lugar da interpretação: terminologia e bases de dados informatizadas

The main objective of this work is to discuss the notion of metalanguage concerning the use of thesaurus (symbols systems, functions indicators, descriptors) utilized by indexers for article representation in computerized bibliographical databases. Our corpus comprises article abstracts and bibliographical database descriptors LILACS (Literatura Latino-Americana em Ciências da Saúde) and SOCIOFILE Sociological Abstracts. We aim at clarifying the effects of subjectivity in the functioning of indexing taking account the grounds for interpretation that allow different meanings.

Estudo inicial da degradação in vivo de poli(L-co-D,L ácido lático), sintetizado em laboratório, aplicado como prótese tibial em coelhos

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Avaliação e conduta em escolares portadores de visão subnormal atendidos em sala de recursos

Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

A Educação Fisica e o discurso midiatico : abordagem critico-emancipatoria em pesquisa-ação no ensino de graduação. Subsidios para a saude?

Universidade Estadual de Campinas . Faculdade de Educação Física

Crescimento da pessoa com Síndrome de Down : contribuição para a construção de um referencial

Universidade Estadual de Campinas . Faculdade de Educação Física

Influencia da atividade fisica na imbagem corporal e percepção de dor de pessoas idosas com dores cronicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação e validação da escla ASKAS - Aging Sexual Knowledge and Attitudes Scale em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física

Saude coletiva e aptdão fisica de escolares de segundo grau : estudo a partis do Colegio Tecnico Industrial - UNESP, Bauru

Universidade Estadual de Campinas . Faculdade de Educação Física

The Sperm Of Hexagenia (pseudeatonica) Albivitta Walker (ephemeroptera: Fossoriae: Ephemeridae)

This study describes the sperm morphology of the mayfly Hexagenia (Pseudeatonica) albivitta (Ephemeroptera). Its spermatozoon measures approximately 30 μm of which 9 μm corresponds to the head. The head is composed of an approximately round acrosomal vesicle and a cylindrical nucleus. The nucleus has two concavities, one in the anterior tip, where the acrosomal vesicle is inserted and a deeper one at its base, where the flagellum components are inserted. The flagellum is composed of an axoneme, a mitochondrion and a dense rod adjacent to the mitochondrion. A centriolar adjunct is also observed surrounding the axoneme in the initial portion of the flagellum and extends along the flagellum for at least 2 μm, surrounding the axoneme in a half-moon shape. The axoneme is the longest component of the flagellum, and it follows the 9+9+0 pattern, with no central pair of microtubules. At the posterior region of the flagellum, the mitochondrion has a dumb-bell shape in cross sections that, together with the rectangular mitochondrial-associated rod, is responsible for the flattened shape of the flagellum. An internal membrane is observed surrounding both mitochondrion and its associated structure.

Análise da pozolanicidade da cinza da casca da castanha do caju pelo método de difratometria de raios X

Atualmente, o aproveitamento de resíduos na construção civil tem sido estimulado, uma vez que esse setor apresenta-se como um dos maiores consumidores de materiais naturais em seus processos e produtos. As cinzas ocupam lugar de destaque entre os resíduos agroindustriais por resultarem de processos de geração de energia. Grande parte dessas cinzas possui atividade pozolânica, podendo ser utilizada como substituto parcial do cimento Portland, resultando numa economia significativa de energia e custo. Este trabalho faz parte de uma pesquisa mais ampla, a qual busca avaliar a viabilidade técnica da cinza da casca da castanha de caju (CCCC) como adição mineral em matrizes de cimento Portland, como também, propor uma metodologia de análise de cinzas agroindustriais. Aplicou-se a técnica de difratometria de raios X para avaliar a reatividade do hidróxido de cálcio pela cinza da casca da castanha de caju em pastas, empregaram-se teores de substituição entre 2,5 e 30,0% e os difratogramas das pastas foram comparados com os das pastas confeccionadas com sílica ativa, executados sobre as mesmas condições de ensaio. Os resultados apontam para a ausência de reatividade pozolânica da CCCC com o cimento Portland.

Distribuição de tensões em mini-implantes ortodônticos

O objetivo deste trabalho foi avaliar a distribuição de tensões na resina em contato com os filetes de roscas de mini-implantes cilíndricos e cônicos, submetidos à carga lateral e torção de inserção. Um modelo fotoelástico foi confeccionado com gelatina transparente, para simular o osso alveolar. O modelo foi observado com um polariscópio plano e fotografado antes e após a ativação dos mini-implantes com força lateral e de inserção. A aplicação de cargas laterais provocou momentos fletores nos mini-implantes, aparecimento de franjas isocromáticas ao longo dos filetes do corpo dos mini-implantes e no ápice. Quando foi aplicado o torque de inserção, verificou-se a concentração de tensões próxima ao ápice. Concluiu-se que: (1) o mini-implante cilíndrico apresentou maior concentração de tensões no ápice, e (2) o mini-implante cônico apresentou maior concentração de tensões nos filetes de rosca apicais.

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 2. Parque Estadual do Alto Ribeira (PETAR), São Paulo State, Brazil

The Parque Estadual do Alto Ribeira (PETAR) with about 250 caves, in an Atlantic forest reserve, is an important ecotourist attraction in the Ribeira Valley, an endemic area of American cutaneous leishmaniasis (ACL). With the purpose of investigating Leishmania vector species bothersome to humans the sandfly fauna was identified and some of its ecological aspects in the Santana nucleus, captures were undertaken monthly with automatic light traps in 11 ecotopes, including caves, forests, a camping site and domiciliary environments, and on black and white Shannon traps, from January/2001 to December/2002. A total of 2,449 sandflies representing 21 species were captured. The highest values of abundance obtained in the captures with automatic light traps were for Psathyromyia pascalei and Psychodopygus ayrozai. A total of 107 specimens representing 13 species were captured on black (12 species) and white (6 species) Shannon traps set simultaneously. Psychodopygus geniculatus females predominated on the black (43.75%), and Psathyromyia lanei and Ps. ayrozai equally (32.4%) on the white. Nyssomyia intermedia and Nyssomyia neivai, both implicated in the transmission of ACL in the Brazilian Southeastern region, were also captured. Ny. intermedia predominated in the open camping area. Low frequencies of phlebotomines were observed in the caves, where Evandromyia edwardsi predominated Lutzomyia longipalpis, the main vector of the American visceral leishmaniasis, was aslo present. This is its most southernly reported occurrence in the Atlantic forest.

Estudo de flebotomíneos (Diptera, Psychodidae) em área urbana do município de Bonito, Mato Grosso do Sul, Brasil

O objetivo do trabalho foi identificar a fauna flebotomínea em áreas do perímetro urbano do município de Bonito, Mato Grosso do Sul, Brasil. O estudo foi desenvolvido de março de 2005 a fevereiro de 2006, em 17 ecótopos distribuídos em 12 locais, três no Centro e nove em diferentes bairros. As capturas foram realizadas quinzenalmente com armadilhas automáticas luminosas. Capturou-se 2.680 espécimes, 2.283 machos e 397 fêmeas, de 12 espécies, Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia corumbaensis, Evandromyia sallesi, Lutzomyia longipalpis, Micropygomyia acanthopharynx, Micropygomyia quinquefer, Nyssomyia whitmani, Psathyromyia aragaoi, Psathyromyia punctigeniculata e Psathyromyia shannoni. Lutzomyia longipalpis, vetora do agente da leishmaniose visceral americana, foi a espécie mais freqüente e a mais abundante, representando 93,5% dos flebotomíneos capturados e índice de abundância padronizado de 0,85. Com freqüência mais expressiva nos ecótopos próximos de galinheiro e de pocilga, esta espécie foi capturada em todos os meses do ano, com picos no verão, inverno e primavera. As demais espécies foram pouco freqüentes. Ressalta-se que a captura de Bichromomyia flaviscutellata, no intradomicilio e peridomicílio, nas proximidade de mata remanescente, tem grande significado epidemiológico uma vez que essa espécie é a principal vetora da Leishmania (Leishmania) amazonensis, agente etiológico da leishmaniose cutânea difusa anérgica. Portanto, na área urbana de Bonito foram encontradas duas espécies que comprovadamente participam da transmissão de leishmanioses, Lutzomyia longipalpis e Bichromomyia flaviscutellata, ambas encontradas naturalmente infectadas pelos respectivos agentes.