Factors Associated With Reporting Of Abuse Against Children And Adolescents By Nurses Within Primary Health Care.

to analyze the factors associated with the underreporting on the part of nurses within Primary Health Care of abuse against children and adolescents. cross-sectional study with 616 nurses. A questionnaire addressed socio-demographic data, profession, instrumentation and knowledge on the topic, identification and reporting of abuse cases. Bivariate and multivariate logistic regression was used. female nurses, aged between 21 and 32 years old, not married, with five or more years since graduation, with graduate studies, and working for five or more years in PHC predominated. The final regression model showed that factors such as working for five or more years, having a reporting form within the PHC unit, and believing that reporting within Primary Health Care is an advantage, facilitate reporting. the study's results may, in addition to sensitizing nurses, support management professionals in establishing strategies intended to produce compliance with reporting as a legal device that ensures the rights of children and adolescents.

Medication Adherence And Quality Of Life Among The Elderly With Diabetic Retinopathy.

one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.

Quality Of Life Of Coronary Artery Disease Patients After The Implementation Of Planning Strategies For Medication Adherence.

to compare the general and specific health-related quality of life (HRQoL) between the Intervention (IG) and Control (CG) groups of coronary artery disease patients after the implementation of Action Planning and Coping Planning strategies for medication adherence and to verify the relationship between adherence and HRQoL. this was a controlled and randomized study. the sample (n=115) was randomized into two groups, IG (n=59) and CG (n=56). Measures of medication adherence and general and specific HRQoL were obtained in the baseline and after two months of monitoring. the findings showed that the combination of intervention strategies - Action Planning and Coping Planning for medication adherence did not affect the HRQoL of coronary artery disease patients in outpatient monitoring.

A metalinguagem como lugar da interpretação: terminologia e bases de dados informatizadas

The main objective of this work is to discuss the notion of metalanguage concerning the use of thesaurus (symbols systems, functions indicators, descriptors) utilized by indexers for article representation in computerized bibliographical databases. Our corpus comprises article abstracts and bibliographical database descriptors LILACS (Literatura Latino-Americana em Ciências da Saúde) and SOCIOFILE Sociological Abstracts. We aim at clarifying the effects of subjectivity in the functioning of indexing taking account the grounds for interpretation that allow different meanings.

Estudo inicial da degradação in vivo de poli(L-co-D,L ácido lático), sintetizado em laboratório, aplicado como prótese tibial em coelhos

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Avaliação e conduta em escolares portadores de visão subnormal atendidos em sala de recursos

Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

A Educação Fisica e o discurso midiatico : abordagem critico-emancipatoria em pesquisa-ação no ensino de graduação. Subsidios para a saude?

Universidade Estadual de Campinas . Faculdade de Educação Física

Crescimento da pessoa com Síndrome de Down : contribuição para a construção de um referencial

Universidade Estadual de Campinas . Faculdade de Educação Física

Influencia da atividade fisica na imbagem corporal e percepção de dor de pessoas idosas com dores cronicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação e validação da escla ASKAS - Aging Sexual Knowledge and Attitudes Scale em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física

Saude coletiva e aptdão fisica de escolares de segundo grau : estudo a partis do Colegio Tecnico Industrial - UNESP, Bauru

Universidade Estadual de Campinas . Faculdade de Educação Física

The Sperm Of Hexagenia (pseudeatonica) Albivitta Walker (ephemeroptera: Fossoriae: Ephemeridae)

This study describes the sperm morphology of the mayfly Hexagenia (Pseudeatonica) albivitta (Ephemeroptera). Its spermatozoon measures approximately 30 μm of which 9 μm corresponds to the head. The head is composed of an approximately round acrosomal vesicle and a cylindrical nucleus. The nucleus has two concavities, one in the anterior tip, where the acrosomal vesicle is inserted and a deeper one at its base, where the flagellum components are inserted. The flagellum is composed of an axoneme, a mitochondrion and a dense rod adjacent to the mitochondrion. A centriolar adjunct is also observed surrounding the axoneme in the initial portion of the flagellum and extends along the flagellum for at least 2 μm, surrounding the axoneme in a half-moon shape. The axoneme is the longest component of the flagellum, and it follows the 9+9+0 pattern, with no central pair of microtubules. At the posterior region of the flagellum, the mitochondrion has a dumb-bell shape in cross sections that, together with the rectangular mitochondrial-associated rod, is responsible for the flattened shape of the flagellum. An internal membrane is observed surrounding both mitochondrion and its associated structure.

Análise da pozolanicidade da cinza da casca da castanha do caju pelo método de difratometria de raios X

Atualmente, o aproveitamento de resíduos na construção civil tem sido estimulado, uma vez que esse setor apresenta-se como um dos maiores consumidores de materiais naturais em seus processos e produtos. As cinzas ocupam lugar de destaque entre os resíduos agroindustriais por resultarem de processos de geração de energia. Grande parte dessas cinzas possui atividade pozolânica, podendo ser utilizada como substituto parcial do cimento Portland, resultando numa economia significativa de energia e custo. Este trabalho faz parte de uma pesquisa mais ampla, a qual busca avaliar a viabilidade técnica da cinza da casca da castanha de caju (CCCC) como adição mineral em matrizes de cimento Portland, como também, propor uma metodologia de análise de cinzas agroindustriais. Aplicou-se a técnica de difratometria de raios X para avaliar a reatividade do hidróxido de cálcio pela cinza da casca da castanha de caju em pastas, empregaram-se teores de substituição entre 2,5 e 30,0% e os difratogramas das pastas foram comparados com os das pastas confeccionadas com sílica ativa, executados sobre as mesmas condições de ensaio. Os resultados apontam para a ausência de reatividade pozolânica da CCCC com o cimento Portland.