1000 resultados para Invariância a escala


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The acceptability of nine commercial brazilian varietal white table wines (Riesling, Chardonnay and Gewürztraminer) was evaluated using sensory affective tests. The samples were assessed by 43 consumers of brazilian white wines using he nine-point structured hedonic scale. Judges were recruited based on their responses to a questionnary about consumer?s behavior towards white wines consumption. Subsequently, Analysis of Variance (ANOVA) with means comparision (Tukey test) and Internal Analysis of Preference Mapping (MDPREF) were performed on data. Analysis of Variance showed that two samples (a Riesling and a Gewürztraminer, both sweet table wines) had significantly (p < 0.05) higher acceptance means, around 7 in the hedonic scale. The least acceptance means (4,3) was obtained by a demi-sec Chardonnay wine and the other six samples achieved means around 5 in the hedonic scale, all of them either demi-sec or dry table wines. MDPREF confirmed the results showed by ANOVA showing that samples were segmented into two groups of preference. The first group was composed by 86% of consumers who prefered the sweet table wines (higher acceptance), converging to the region on the map where these samples were represented. Only 14% showed preference for the demi-sec and dry table wines, being represented on the region of the MDPREF where these samples were located. This study suggests that sweet table wines are prefered by Brazilian consumers, instead of dry or demi-sec table wines.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Fisica

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física