Increased Expression Of Hes5 Protein In Notch Signaling Pathway In The Hippocampus Of Mice Offspring Of Dams Fed A High-fat Diet During Pregnancy And Suckling.

Maternal high-fat diet (HFD) impairs hippocampal development of offspring promoting decreased proliferation of neural progenitors, in neuronal differentiation, in dendritic spine density and synaptic plasticity reducing neurogenic capacity. Notch signaling pathway participates in molecular mechanisms of the neurogenesis. The activation of Notch signaling leads to the upregulation of Hes5, which inhibits the proliferation and differentiation of neural progenitors. This study aimed to investigate the Notch/Hes pathway activation in the hippocampus of the offspring of dams fed an HFD. Female Swiss mice were fed a control diet (CD) and an HFD from pre-mating until suckling. The bodyweight and mass of adipose tissue in the mothers and pups were also measured. The mRNA and protein expression of Notch1, Hes5, Mash1, and Delta1 in the hippocampus was assessed by RT-PCR and western blotting, respectively. Dams fed the HFD and their pups had an increased bodyweight and amount of adipose tissue. Furthermore, the offspring of mothers fed the HFD exhibited an increased Hes5 expression in the hippocampus compared with CD offspring. In addition, HFD offspring also expressed increased amounts of Notch1 and Hes5 mRNA, whereas Mash1 expression was decreased. However, the expression of Delta1 did not change significantly. We propose that the overexpression of Hes5, a Notch effector, downregulates the expression of the proneural gene Mash1 in the offspring of obese mothers, delaying cellular differentiation. These results provide further evidence that an offspring's hippocampus is molecularly susceptible to maternal HFD and suggest that Notch1 signaling in this brain region is important for neuronal differentiation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Antioxidative responses of cell suspension cultures of two Coffea arabica varieties to low aluminum levels at pH 5.8

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Treinamento concorrente : efeito sobre marcadores inflamatórios sistêmicos e indicadores funcionais em homens de meia idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Alterações no desempenho fisico de corredores de elite do atletismo brasileiro apos quatro semanas de destrinamento

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptações musculares ao treinamento de força com sobrecargas excentricas

Universidade Estadual de Campinas . Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação dos indicadores funcionais e bioquimicos em homens de meia-idade submetidos a treinamento aerobio e corredores de longa distancia

Universidade Estadual de Campinas . Faculdade de Educação Física

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Quality evaluation of DNA obtained from stored human saliva and its applicability to identification in Forensic Dentistry

PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.