980 resultados para Great-Barrier-Reef


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Joidenkin tutkimusten mukaan naisten vähäinen määrä johdossa voi olla uhka organisaatiolle. Lasikattoilmiöllä tarkoitetaan naisten urakehityksen katkeamista tietylle tasolle ylimmän johdon alapuolelle ikään kuin naisten ja tuon ylimmän tason välissä olisi lasinen, näkymätön katto, sukupuolistereotypioiden muodostama este. Yksi yleinen lasikaton selitysten kolmijako on henkilökohtaiset, organisatoriset ja yhteiskunnalliset tekijät. (Lämsä & Hautala 2004, 252). Hoyt (2007, 270-278) tekee kolmijaon seuraavasti: inhimillinen pääoma, sukupuolierot ja ennakkoluulot. Yritys X:n keskijohdossa työskentelee yksi nainen, ylimmässä johdossa ei yhtäkään. Tutkimuksessa halu-taan selvittää miesjohtajien ja ei-johtavassa asemassa olevien naisten käsitystä siitä, onko yritys x:ssä lasi-kattoa, miksi naisjohtajia on niin vähän ja "mitä siitä" ts. onko mitään ongelmaa olemassakaan. Tässä tutkimuksessa pohditaan diskurssianalyysin keinoin, miten yritys X:ssä puhutaan naisjohtajuusaiheesta, millai-seksi sukupuolen merkitys työelämässä määritellään ja mitä ajatellaan naisten kykenevyydestä johtajiksi. Naturalisoiva diskurssi oli vahva niin miesjohtajien ja ei-johtavassa asemassa olevien naisten puheessa. Sen lisäksi hahmotellaan familistista, empiiristä, humanistista ja historiallista diskurssia naisjohtajuuspuheesta. Diskurssien yhteenkietominen hegemonisoimisstrategiana kuvaa tapaa, jolla palasia muista diskursseista käytetään tukemaan tiettyä toista diskurssia (Jokinen et al. 1993c, 95) Miesjohtajien puheessa naisten keskeiset, ominaisuudet - liiallinen tarkkuus ja huolellisuus yhdistettynä epävarmuuteen - ovat ongelmallisia johtajanuran kannalta. Jos näistä johtajuuden kannalta negatiivisista ominaisuuksista ei jostain syystä kuitenkaan muodostuisi uralla etenemisen estettä, äitiys ja perheellisyys "luonnollisesti" tekee tämän. Aiheet myös kietoutuvat yhteen: äitiys ja vastuu perheestä lisäävät naisten huolellisuutta, tarkkuutta ja epävarmuutta entisestään. Lisäksi äitiyslomat ja työhön käytettävissä oleva aika ja puut-tuva halu käyttää elämästä iso osa uranluomiseen ovat johtajaksi etenemisen esteitä. Miesjohtajien mukaan tämä on jossain määrin ongelma, kun heterogeenisyyttä johtamiseen kuitenkin tarvittaisiin, mutta loppujen lopuksi kuitenkin melko epäkiinnostava ja pieni ongelma; ongelma ei miesten mielestä johdu miesten tai yhteiskunnallisista asenteista, vaan naisista itsestään ja he tarvitsevat uralla edetäkseen tukea, rohkaisua ja henkilöstöpankkeja, joita miesjohtajat voivat tuottaa. Johtaminen ylipäänsä ei ole miesjohtajien mielestä hirveän kiinnostavaa. Jos naiset (kaikesta edellä sanotusta huolimatta) etenevät yritysten johtoon, eivät he tule siellä toimeen keskenään. Kaiken kaikkiaan koko naisjohtajuusaihe ei ole kovin kiinnostava ja naisjohtajuuden vähäisyyden (mahdollisen) ongelman ratkaisee aika uuden, tasa-arvoisemman sukupolven myötä. Naishaastateltujen näkökulmasta sen sijaan naisilla on pyrkyä johtotehtäviin - joskaan ei samassa määrin kuin miehillä. Naishaastateltujen mukaan miehet suosivat toisiaan työelämässä ja naiset kohtaavat asenteita, joita vastaan joutuvat taistelemaan ja tästä syystä johtajien joukossa on niin vähän naisia. Historialliset tekijät pitävät asenteita yllä. Perheellisyys on naisille suurempi uraeste kuin miehille, "luonnollisesti". Naishaastateltujen mielestä naisten vähäisyys johdossa on merkittävä ongelma, koska naisilla on erityislaatuisia ominaisuuksia, joista olisi hyötyä tehtävässä. Naishaastateltujen puheessa miesten ominaisuuksia vastaavasti vähäteltiin. Naisjohtajien vähäisyyden ongelmalle ei naishaastateltujen mielestä kuitenkaan ole tehtävissä paljonkaan: miesten ja yhteiskunnan asenteiden pitäisi muuttua, mutta keinoja tähän ei esitetä, sen sijaan naisten itsensä pitäisi vain "yrittää vielä kovemmin".

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The National Library of Finland realizes the Digitization Project of Kindred Languages in 2012–15. The project is financially supported by the Kone Foundation. During this project the National Library of Finland has digitized and made available approximately 1200 monograph and more than 100 newspaper titles in several Uralic languages. The materials are available to both researchers and citizens in the National Library’s Fenno-Ugrica collection. The project will produce digitized materials in the Uralic languages as well as their development tools to support linguistic research and citizen science. The resulting materials will constitute the largest resource for the Uralic languages in the world. Through this project, researchers will gain access to corpora which they have not been able to study before and to which all users will have open access regardless of their place of residence. In my presentation, I will discuss 1) how we utilized the social media (Facebook, Twitter, VKontakte etc) to gain audience for our collection and 2) how the needs of researchers and laymen were met in crowdsourcing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Työilmoitus voi jäädä työnhakijan ja työnantajan välillä ainoaksi viestinnän mahdollisuudeksi, jolloin ratkaisevaa on, kuinka houkuttelevaksi työnantaja työilmoituksensa laatii kilpaillessaan halutuista osaajista. Samalla työilmoitus antaa lupauksia tulevasta työstä ja työyhteisöstä. Tämän tutkimuksen perimmäinen tarkoitus on tutkia, näkyykö työsuhteen kahdenvälinen transaktioluonne työilmoitusten tasolla eli kerrotaanko ilmoituksissa työnantajan osaajatarpeiden lisäksi, mitkä olisivat työntekijän työllistymisellä saavutetut hyödyt. Tarkemmiksi tarkastelun kohteiksi on valittu kaksi työnhakijan päätöksenteon kannalta mielenkiintoista näkökulmaa: viestityt työarvot ja työnantajalupaukset. Teoreettiselta taustaltaan tämä tutkimus liittyy rekrytoinnin kokonaisuuteen, mutta se sivuaa useita muita aihealueita, kuten yksilön ja yrityksen yhteensopivuutta, työnantajamielikuvaa, psykologista sopimusta, informaation prosessointia, suostuttelua ja työnhakupäätöksen syntymekanismin tutkimusta. Tutkimuksen empiirinen aineisto koostuu kolmena peräkkäisenä vuonna (2013−2015) Suomen parhaimmiksi työnantajiksi tituleerattujen yritysten julkaisemista työilmoituksista. Näiden oletettiin olevan kiinnostuneita työnantajakuvastaan ja rekrytoinnistaan keskimääräistä enemmän. Kerätyistä 19 työilmoituksesta tulkittiin arvoilmaisuja ja annettuja esilupauksia kahden teoreettisen luokituksen yhdistelmänä muodostetun analyysirungon avulla. Aineiston lauseita eriteltiin analyysirungon teemojen alle ja niiden vakuuttamiskeinoja analysoitiin retorisella diskurssianalyysillä. Tutkimuksen tuloksena havaittiin, että työnteon puitteista, palkkatiedoista, määräysvallasta ja työn merkityksellisyydestä mainittiin verrattain vähän työilmoituksissa. Sen sijaan aineiston työilmoituksista löytyi runsaasti ilmaisuja, joista työnhakija voi tehdä päätelmiä työilmapiiristä tai potentiaalisten kollegoiden asiantuntijuuden tasosta. Yrittäjähenkisyys- ja suorituspainepuheiden läpi heijastui puolestaan kovemmat arvot. Arvojen ilmaisu tapahtui usein epäsuorasti kuin selkeinä arvolistoina. Konkreettisia lupauksia työnantajalta työnhakijalle tehtiin vähän tai ne olivat ylimalkaisia. Tutkimus antaa aihetta laajemmille kartoituksille. Mitkä ovat syyt tiettyä kaavaa toistavien työilmoitusten taustalla ja mitkä tekijät työilmoituksissa eri kohdeyleisöjä aidosti vaikuttavat?