1000 resultados para Eventos e comemorações culturais


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This retrospective paper will shed light on the relations between Linguistics and Archaeology by drawing special attention to the history of Archaeology and the influence of Linguistic models for the development of archaeological interpretive frameworks. Reference will be made to culture history theoreticians, like Gordon Childe, to processual archaeologists influenced by Structuralism and to post-processual discourse analysis. The paper will conclude stressing the importance of Linguistics to archaeological thought.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article intends to discuss the relationship between morality, democracy and education within the perspective of the complex thinking, pointing to paths and proposals for its effective implementation in the educational routine, under the conviction that this is an imperative of the new social demands presented to the contemporary schooling. Understanding that one of the purposes of education is the ethical development, the author proposes intentional actions such that through them the school practices can offer to the subjects of education the necessary tools to build their cognitive, affective, cultural, and organic competence, thereby enabling them to act morally in the world. To that effect, seven aspects of school reality that hamper or contribute to school democratization are identified and discussed, which must be understood from the paradigm of complexity: school contents, classroom methodology, the nature of interpersonal relationships, the values, self-esteem and self-knowledge of the school community, as well as the school management processes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One of the effects of the globalized world is a strong tendency to eliminate differences, promoting a planetary culture. Education systems are particularly affected, undergoing strong pressure from international studies and evaluations, inevitably comparative, and sadly competitive. As a result, one observes the gradual elimination of cultural components in the definition of education systems. The constitution of new social imaginaries becomes clear; imaginaries empty of historical, geographical and temporal referents, characterized by a strong presence of the culture of the image. The criteria of classification establish an inappropriate reference that has as its consequence the definition of practices and even of education systems. On the other hand, resistance mechanisms, often unconscious, are activated seeking to safeguard and recover the identifying features of a culture, such as its traditions, cuisine, languages, artistic manifestations in general, and, in doing so, to contribute to cultural diversity, an essential factor to encourage creativity. In this article, the sociocultural basis of mathematics and of its teaching are examined, and also the consequences of globalization and its effects on multicultural education. The concept of culture is discussed, as well as issues related to culture dynamics, resulting in the proposition of a theory of transdisciplinar and transcultural knowledge. Upon such basis the Ethnomathematics Program is presented. A critique is also made of the curriculum presently used, which is in its conception and detailing, obsolete, uninteresting and of little use. A different concept of curriculum is proposed, based on the communicative (literacy), analytical (matheracy), and material (technoracy) instruments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física