974 resultados para Active-site
Resumo:
Background and Purpose - This study was undertaken to better clarify the risks associated with cigarette smoking and subarachnoid hemorrhage (SAH). Methods - The study included 432 incident cases of SAH frequency matched to 473 community SAH-free controls to determine dose-dependent associations of active and passive smoking ( at home) and smoking cessation with SAH. Results - Compared with never smokers not exposed to passive smoking, the adjusted odds ratio for SAH among current smokers was 5.0 (95% confidence interval [CI], 3.1 to 8.1); for past smokers, 1.2 ( 95% CI, 0.8 to 2.0); and for passive smokers, 0.9 ( 95% CI, 0.6 to 1.5). Current and lifetime exposures showed a clear dose-dependent effect, and risks appeared more prominent in women and for aneurysmal SAH. Approximately 1 in 3 cases of SAH could be attributed to current smoking, but risks decline quickly after smoking cessation, even among heavy smokers. Conclusions - A strong positive association was found between cigarette smoking and SAH, especially for aneurysmal SAH and women, which is virtually eliminated within a few years of smoking cessation. Large opportunities exist for preventing SAH through smoking avoidance and cessation programs.
Resumo:
The high speciFIcity of alpha-conotoxins for different neuronal nicotinic acetylcholine receptors makes them important probes for dissecting receptor subtype selectivity. New sequences continue to expand the diversity and utility of the pool of available alpha-conotoxins. Their identification and characterization depend on a suite of techniques with increasing emphasis on mass spectrometry and microscale chromatography, which have benefited from recent advances in resolution and capability. Rigorous physicochemical analysis together with synthetic peptide chemistry is a prerequisite for detailed conformational analysis and to provide sufficient quantities of alpha-conotoxins for activity assessment and structure-activity relationship studies.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Nest orientation in social insects has been intensively studied in warmer and cooler climates, particularly in the northern hemisphere. Previous studies have consistently shown that species subjected to these climatic conditions prefer to select mostly southern locations where the nests can gain direct sunlight. However, very little is known on nest orientation in tropical and subtropical social insects. We studied nest orientations initiated by swarms throughout a year in a Brazilian swarm-founding wasp, Polybia paulista von Ihering (Hymenoptera: Polistinae). Swarms selected various orientations as nest sites, but there was a particular trend in that swarms in the winter period (May-August) preferred to build northward-facing nests. This preference is opposite from that of social wasps observed in the northern hemisphere. Colonies of this species can potentially last for many years with continuous nesting, but nesting activities of colonies during the winter are severely limited due to cool temperature and a shortened day length. Northward-facing nests are warmer through the gain of direct solar heat during the winter period; consequently, choosing northward-facing sites may be advantageous for swarms in terms of a shortened brood development and shortened time needed to increase metabolic rates during warm-up for flight.
Resumo:
The efficient expression and purification of an interfacially active peptide (mLac21) was achieved by using bioprocess-centered molecular design (BMD), wherein key bioprocess considerations are addressed during the initial molecular biology work. The 21 amino acid mLac21 peptide sequence is derived from the lac repressor protein and is shown to have high affinity for the oil-water interface, causing a substantial reduction in interfacial tension following adsorption. The DNA coding for the peptide sequence was cloned into a modified pET-31(b) vector to permit the expression of mLac21 as a fusion to ketosteroid isomerase (KSI). Rational iterative molecular design, taking into account the need for a scaleable bioprocess flowsheet, led to a simple and efficient bioprocess yielding mLac21 at 86% purity following ion exchange chromatography (and >98% following chromatographic polishing). This case study demonstrates that it is possible to produce acceptably pure peptide for potential commodity applications using common scaleable bioprocess unit operations. Moreover, it is shown that BMD is a powerful strategy that can be deployed to reduce bioseparation complexity. (C) 2004 Wiley Periodicals, Inc.
Resumo:
In this Letter we describe a 12% overall yield synthesis of a model for homoallylic oxygenated alpha-methylene-gamma-butyrolactones with relative stereochemistry defined by selective hydrogenation with Rh/Al(2)O(3). The synthesis was realized in 9 steps involving simple reactions. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
We have characterized the kinetic properties of ectonucleoside triphosphate diphosphohydrolase 1 (E-NTPDase1) from rat osseous plate membranes. A novel finding of the present study is that the solubilized enzyme shows high- and low-affinity sites for the substrate in contrast with a single substrate site for the membrane-bound enzyme. In addition, contrary to the Michaelian chraracteristics of the membrane-bound enzyme, the site-site interactions after solubilization with 0.5% digitonin plus 0.1% lysolecithin resulted in a less active ectonucleoside triphosphate diphosphohydrolase, showing activity of about 398.3 nmol Pi min(-1) mg(-1). The solubilized enzyme has M(r) of 66-72 kDa, and its catalytic efficiency was significantly increased by magnesium and calcium ions; but the ATP/ADP activity ratio was always < 2.0. Partial purification and kinetic characterization of the rat osseous plate E-NTPDase1 in a solubilized form may lead to a better understanding of a possible function of the enzyme as a modulator of nucleotidase activity or purinergic signaling in matrix vesicle membranes. The simple procedure to obtain the enzyme in a solubilized form may also be attractive for comparative studies of particular features of the active sites from this and other ATPases.
Resumo:
Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.
Resumo:
Chinese Hamster Ovary (CHO) cells are widely used for the large scale production of recombinant biopharmaceuticals. Growth of the CHO-K1 cell line has been demonstrated in serum-free medium containing insulin, transferrin and selenium. In an attempt to get autocrine growth in protein-free medium, DNA coding for insulin and transferrin production was transfected into CHO-K1 cells. Transferrin was expressed well, with clones secreting approximately 1000 ng/10(6)cells/24h. Insulin was poorly expressed, with rates peaking at 5 ng/10(6)cells/24h. Characterisation of the secreted insulin indicated that the CHO cells were incompletely processing the insulin molecule. Site-directed mutagenesis was used to introduce a furin (prohormone converting enzyme) recognition sequence into the insulin molecule, allowing the production of active insulin. However, the levels were still too low to support autocrine growth. Further investigations revealed insulin degrading activity (presumably due to the presence of insulin degrading enzymes) in the cytoplasm of CHO cells. To overcome these problems insulin-like growth factor I (instead of insulin) was transfected into the cells. IGF-1 was completely processed and expressed at rates greater than 500 ng/10(6)cells/24h. In this paper we report autonomous growth of the transfected CHO-K1 cell line expressing transferrin and IGF-1 in protein-free medium without the addition of exogenous growth factors. Growth rates and final cell densities of these cells were identical to that of the parent cell line CHO-K1 growing in insulin, transferrin, and selenium supplemented serum-free media.
Resumo:
Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).