976 resultados para soil microbial activity
Resumo:
Reduction in sirtuin 1 (Sirt-1) is associated with extracellular matrix (ECM) accumulation in the diabetic kidney. Theobromine may reduce kidney ECM accumulation in diabetic rats. In the current study, we aimed to unravel, under diabetic conditions, the mechanism of kidney ECM accumulation induced by a reduction in Sirt-1 and the effect of theobromine in these events. In vitro, we used immortalized human mesangial cells (iHMCs) exposed to high glucose (HG; 30 mM), with or without small interfering RNA for NOX4 and Sirt-1. In vivo, spontaneously hypertensive rats (SHR) were rendered diabetic by means of streptozotocin and studied after 12 wk. The effects of treatment with theobromine were investigated under both conditions. HG leads to a decrease in Sirt-1 activity and NAD(+) levels in iHMCs. Sirt-1 activity could be reestablished by treatment with NAD(+), silencing NOX4, and poly (ADP-ribose) polymerase-1 (PARP-1) blockade, or with theobromine. HG also leads to a low AMP/ATP ratio, acetylation of SMAD3, and increased collagen IV, which is prevented by theobromine. Sirt-1 or AMPK blockade abolished these effects of theobromine. In diabetic SHR, theobromine prevented increases in albuminuria and kidney collagen IV, reduced AMPK, elevated NADPH oxidase activity and PARP-1, and reduced NAD(+) levels and Sirt-1 activity. These results suggest that in diabetes mellitus, Sirt-1 activity is reduced by PARP-1 activation and NAD(+) depletion due to low AMPK, which increases NOX4 expression, leading to ECM accumulation mediated by transforming growth factor (TGF)-β1 signaling. It is suggested that Sirt-1 activation by theobromine may have therapeutic potential for diabetic nephropathy.
Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.
Resumo:
In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.
Resumo:
Vasodilator-stimulated phosphoprotein (VASP) and Zyxin are interacting proteins involved in cellular adhesion and motility. PKA phosphorylates VASP at serine 157, regulating VASP cellular functions. VASP interacts with ABL and is a substrate of the BCR-ABL oncoprotein. The presence of BCR-ABL protein drives oncogenesis in patients with chronic myeloid leukemia (CML) due to a constitutive activation of tyrosine kinase activity. However, the function of VASP and Zyxin in BCR-ABL pathway and the role of VASP in CML cells remain unknown. In vitro experiments using K562 cells showed the involvement of VASP in BCR-ABL signaling. VASP and Zyxin inhibition decreased the expression of anti-apoptotic proteins, BCL2 and BCL-XL. Imatinib induced an increase in phosphorylation at Ser157 of VASP and decreased VASP and BCR-ABL interaction. VASP did not interact with Zyxin in K562 cells; however, after Imatinib treatment, this interaction was restored. Corroborating our data, we demonstrated the absence of phosphorylation at Ser157 in VASP in the bone marrow of CML patients, in contrast to healthy donors. Phosphorylation of VASP on Ser157 was restored in Imatinib responsive patients though not in the resistant patients. Therefore, we herein identified a possible role of VASP in CML pathogenesis, through the regulation of BCR-ABL effector proteins or the absence of phosphorylation at Ser157 in VASP.
Resumo:
A discussion about groundwater contamination is presented in this work. Contamination by agricultural activity, more specifically by pesticides is emphasized. Indirect and direct estimates could be used to predict pesticide behavior in soil, and consequently, to evaluate the potential of groundwater contamination. These results could be applied to advise about the possibility of groundwater contamination by pesticides, and to provide subsidies for making decisions more quickly and efficiently.
Resumo:
Antimycobacterial and cytotoxicity activity of synthetic and natural compounds. Secondary metabolites from Curvularia eragrostidis and Drechslera dematioidea, Clusia sp. floral resin, alkaloids from Pilocarpus alatus, salicylideneanilines, piperidine amides, the amine 1-cinnamylpiperazine and chiral pyridinium salts were assayed on Mycobacterium tuberculosis H37Rv. N-(salicylidene)-2-hydroxyaniline was the most effective compound with a minimal inhibitory concentration (MIC) of 8 µmol/L. Dihydrocurvularin was moderately effective with a MIC of 40 µmol/L. Clusia sp. floral resin and a gallocatechin-epigallocatechin mixture showed MIC of 0.02 g/L and 38 µmol/L, respectively. The cytotoxicity was evaluated for N-(salicylidene)-2-hydroxyaniline, curvularin, dihydrocurvularin and Clusia sp. floral resin, and the selectivity indexes were > 125, 0.47, 0.75 and 5, respectively.
Resumo:
The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.
Resumo:
This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.
Resumo:
Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This study evaluated in vitro the antibacterial activity of 4 root canal filling materials for primary teeth - zinc oxide and eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO), Sealapex sealer and EndoREZ sealer - against 5 bacterial strains commonly found in endodontic infections (Kocuria rhizophila, Enterococcus faecalis, Streptococcus mutans, Escherichia coli and Staphylococcus aureus) using the agar diffusion test (agar-well technique). Calen paste, 1% chlorhexidine digluconate (CHX) and distilled water served as controls. Seven wells per dish were made at equidistant points and immediately filled with the test and control materials. After incubation of the plates at 37oC for 24 h, the diameter of the zones of bacterial growth inhibition produced around the wells was measured (in mm) with a digital caliper under reflected light. Data were analyzed statistically by analysis of variance and Tukey's post-hoc test (?=0.05). There were statistically significant differences (p<0.0001) among the zones of bacterial growth inhibition produced by the different materials against all target microorganisms. K. rhizophila was inhibited more effectively (p<0.05) by ZOE, while Calen/ZO had its highest antibacterial activity against E. faecalis (p<0.05). S. mutans was inhibited by Calen/ZO, Sealapex and ZOE in the same intensity (p>0.05). E. coli was inhibited more effectively (p<0.05) by ZOE, followed by Calen/ZO and Sealapex. Calen/ZO and ZOE were equally effective (p>0.05) against S. aureus, while Sealapex had the lowest antibacterial efficacy (p<0.05) against this microorganism. EndoREZ presented antibacterial activity only against K. rhizophila and S. aureus. The Calen paste and Calen/ZO produced larger zones of inhibition than 1% CHX when the marker microorganism was E faecalis. In conclusion, the in vitro antibacterial activity of the 4 root canal filling materials for primary teeth against bacterial strains commonly found in endodontic infections can be presented in a decreasing order of efficacy as follows: ZOE>Calen/ZO>Sealapex>EndoREZ.
Resumo:
The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.
Resumo:
The purpose of this study was to analyze the electromyographic (EMG) activity and the maximal molar bite force in women diagnosed with osteoporosis in the maxillary and mandibular regions, considering the habits and conditions that lead to development of generalized skeletal bone loss, including on face bones, can disturb the functional harmony of the stomatognathic system. Twenty-seven women with mandibular and maxillary osteoporosis and 27 healthy controls volunteered to participate in the study. A 5-channel electromyographer was used. Muscle activity was evaluated by means of EMG recordings of the masticatory musculature (masseter and temporalis muscles, bilaterally) during the following clinical conditions: rest (5 s); right and left lateral excursions (5 s); protrusion (5 s); maximal dental clenching on Parafilm™ (4 s) and maximal voluntary contraction (4 s). This latter clinical condition was used as the normalization factor of the sample data. It was observed that individuals with osteoporosis presented greater EMG activity when maintaining mandible posture conditions and less activity during dental clenching and when obtaining maximal molar bite force. It may be concluded that facial osteoporosis can interfere on the patterns of masticatory muscle activation and maximal bite force of the stomatognathic system.