In Vivo Determination Of The Volatile Metabolites Of Saprotroph Fungi By Comprehensive Two-dimensional Gas Chromatography.

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

New Fefe-hydrogenase Genes Identified In A Metagenomic Fosmid Library From A Municipal Wastewater Treatment Plant As Revealed By High-throughput Sequencing.

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

The Influence Of The Buffering Capacity On The Production Of Organic Acids And Alcohols From Wastewater In Anaerobic Reactor.

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Produção de isomaltulose, um substituto da sacarose, utilizando glicosiltransferase microbiana

Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

ESTUDO DA PREPARAÇÃO DOS EXTRATOS DE PRÓPOLIS E SUAS APLICAÇÕES

Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Clinical and antimicrobial efficacy of NitrAdineTM-based disinfecting cleaning tablets in complete denture wearers

OBJECTIVE: This study evaluated the efficacy of NitrAdineTM-based disinfecting cleaning tablets for complete denture, in terms of denture biofilm removal and antimicrobial action. MATERIAL AND METHODS: Forty complete denture wearers (14 men and 26 women) with a mean age of 62.3±9.0 years were randomly assigned to two groups and were instructed to clean their dentures according to two methods: brushing (control) - 3 times a day with denture brush and tap water following meals; brushing and immersion (Experimental) - brushing the denture 3 times a day with denture brush and tap water following meals and immersion of the denture in NitrAdineTM-based denture tablets (Medical InterporousTM). Each method was used for 21 days. Denture biofilm was disclosed by a 1% neutral red solution and quantified by means of digital photos taken from the internal surface before and after the use of the product. Microbiological assessment was conducted to quantify Candida sp. RESULTS: An independent t-test revealed a significant lower biofilm percentage for the experimental group (4.7, 95% CI 2.4 to 7.9) in comparison with the control group (mean 37.5, 95% CI 28.2 to 48.1) (t38=7.996, p<0.001). A significant reduction of yeast colony forming units could be found after treatment with Medical InterporousTM denture tablets as compared to the control group (Mann-Whitney test, Z=1.90; p<0.05). CONCLUSION: The present findings suggest that NitrAdineTM-based disinfecting cleaning tablets are efficient in removal of denture biofilm. In addition, a clear antimicrobial action was demonstrated. Therefore, they should be recommended as a routine denture maintenance method for the prevention of the development of microbial biofilm induced denture stomatitis.