994 resultados para barrier repair cost
Evaluation of radioinduced damage and repair capacity in blood lymphocytes of breast cancer patients
Resumo:
Genetic damage caused by ionizing radiation and repair capacity of blood lymphocytes from 3 breast cancer patients and 3 healthy donors were investigated using the comet assay. The comets were analyzed by two parameters: comet tail length and visual classification. Blood samples from the donors were irradiated in vitro with a 60Co source at a dose rate of 0.722 Gy/min, with a dose range of 0.2 to 4.0 Gy and analyzed immediately after the procedure and 3 and 24 h later. The basal level of damage and the radioinduced damage were higher in lymphocytes from breast cancer patients than in lymphocytes from healthy donors. The radioinduced damage showed that the two groups had a similar response when analyzed immediately after the irradiations. Therefore, while the healthy donors presented a considerable reduction of damage after 3 h, the patients had a higher residual damage even 24 h after exposure. The repair capacity of blood lymphocytes from the patients was slower than that of lymphocytes from healthy donors. The possible influence of age, disease stage and mutations in the BRCA1 and BRCA2 genes are discussed. Both parameters adopted proved to be sensitive and reproducible: the dose-response curves for DNA migration can be used not only for the analysis of cellular response but also for monitoring therapeutic interventions. Lymphocytes from the breast cancer patients presented an initial radiosensitivity similar to that of healthy subjects but a deficient repair mechanism made them more vulnerable to the genotoxic action of ionizing radiation. However, since lymphocytes from only 3 patients and 3 normal subjects were analyzed in the present paper, additional donors will be necessary for a more accurate evaluation.
Resumo:
The complex nature of spinal cord injury appears to demand a multifactorial repair strategy. One of the components that will likely be included is an implant that will fill the area of lost nervous tissue and provide a growth substrate for injured axons. Here we will discuss the role of Schwann cells (SCs) in cell-based, surgical repair strategies of the injured adult spinal cord. We will review key studies that showed that intraspinal SC grafts limit injury-induced tissue loss and promote axonal regeneration and myelination, and that this response can be improved by adding neurotrophic factors or anti-inflammatory agents. These results will be compared with several other approaches to the repair of the spinal cord. A general concern with repair strategies is the limited functional recovery, which is in large part due to the failure of axons to grow across the scar tissue at the distal graft-spinal cord interface. Consequently, new synaptic connections with spinal neurons involved in motor function are not formed. We will highlight repair approaches that did result in growth across the scar and discuss the necessity for more studies involving larger, clinically relevant types of injuries, addressing this specific issue. Finally, this review will reflect on the prospect of SCs for repair strategies in the clinic.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
We report a fast (less than 3 h) and cost-effective melting temperature assay method for the detection of single-nucleotide polymorphisms in the MBL2 gene. The protocol, which is based on the Corbett Rotor Gene real time PCR platform and SYBR Green I chemistry, yielded, in the cohorts studied, sensitive (100%) and specific (100%) PCR amplification without the use of costly fluorophore-labeled probes or post-PCR manipulation. At the end of the PCR, the dissociation protocol included a slow heating from 60º to 95ºC in 0.2ºC steps, with an 8-s interval between steps. Melting curve profiles were obtained using the dissociation software of the Rotor Gene-3000 apparatus. Samples were analyzed in duplicate and in different PCR runs to test the reproducibility of this technique. No supplementary data handling is required to determine the MBL2 genotype. MBL2 genotyping performed on a cohort of 164 HIV-1-positive Brazilian children and 150 healthy controls, matched for age and sex and ethnic origin, yielded reproducible results confirmed by direct sequencing of the amplicon performed in blind. The three MBL2 variants (Arg52Cys, Gly54Asp, Gly57Glu) were grouped together and called allele 0, while the combination of three wild-type alleles was called allele A. The frequency of the A/A homozygotes was significantly higher among healthy controls (0.68) than in HIV-infected children (0.55; P = 0.0234) and the frequency of MBL2 0/0 homozygotes was higher among HIV-1-infected children than healthy controls (P = 0.0296). The 0 allele was significantly more frequent among the 164 HIV-1-infected children (0.29) than among the 150 healthy controls (0.18; P = 0.0032). Our data confirm the association between the presence of the mutated MBL2 allele (allele 0) and HIV-1 infection in perinatally exposed children. Our results are in agreement with the literature data which indicate that the presence of the allele 0 confers a relative risk of 1.37 for HIV-1 infection through vertical transmission.
Resumo:
Efficient production and consumption of energy has become the top priority of national and international policies around the world. Manufacturing industries have to address the requirements of the government in relation to energy saving and ecologically sustainable products. These industries are also concerned with energy and material usage due to their rising costs. Therefore industries have to find solutions that can support environmental preservation yet maintain competitiveness in the market. Welding, a major manufacturing process, consumes a great deal of material and energy. It is a crucial process in improving a product’s life-cycle cost, strength, quality and reliability. Factors which lead to weld related inefficiencies have to be effectively managed, if industries are to meet their quality requirements and fulfil a high-volume production demand. Therefore it is important to consider some practical strategies in welding process for optimization of energy and material consumption. The main objective of this thesis is to explore the methods of minimizing the ecological footprint of the welding process and methods to effectively manage its material and energy usage in the welding process. The author has performed a critical review of the factors including improved weld power source efficiency, efficient weld techniques, newly developed weld materials, intelligent welding systems, weld safety measures and personnel training. The study lends strong support to the fact that the use of eco-friendly welding units and the quality weld joints obtained with minimum possible consumption of energy and materials should be the main directions of improvement in welding systems. The study concludes that, gradually implementing the practical strategies mentioned in this thesis would help the manufacturing industries to achieve on the following - reduced power consumption, enhanced power control and manipulation, increased deposition rate, reduced cycle time, reduced joint preparation time, reduced heat affected zones, reduced repair rates, improved joint properties, reduced post-weld operations, improved automation, improved sensing and control, avoiding hazardous conditions and reduced exposure of welder to potential hazards. These improvement can help in promotion of welding as a green manufacturing process.
Resumo:
The main objective of this Master’s thesis is to develop a cost allocation model for a leading food industry company in Finland. The goal is to develop an allocation method for fixed overhead expenses produced in a specific production unit and create a plausible tracking system for product costs. The second objective is to construct an allocation model and modify the created model to be suited for other units as well. Costs, activities, drivers and appropriate allocation methods are studied. This thesis is started with literature review of existing theory of ABC, inspecting cost information and then conducting interviews with officials to get a general view of the requirements for the model to be constructed. The familiarization of the company started with becoming acquainted with the existing cost accounting methods. The main proposals for a new allocation model were revealed through interviews, which were utilized in setting targets for developing the new allocation method. As a result of this thesis, an Excel-based model is created based on the theoretical and empiric data. The new system is able to handle overhead costs in more detail improving the cost awareness, transparency in cost allocations and enhancing products’ cost structure. The improved cost awareness is received by selecting the best possible cost drivers for this situation. Also the capacity changes are taken into consideration, such as usage of practical or normal capacity instead of theoretical is suggested to apply. Also some recommendations for further development are made about capacity handling and cost collection.
Resumo:
Electrical machine drives are the most electrical energy-consuming systems worldwide. The largest proportion of drives is found in industrial applications. There are, however many other applications that are also based on the use of electrical machines, because they have a relatively high efficiency, a low noise level, and do not produce local pollution. Electrical machines can be classified into several categories. One of the most commonly used electrical machine types (especially in the industry) is induction motors, also known as asynchronous machines. They have a mature production process and a robust rotor construction. However, in the world pursuing higher energy efficiency with reasonable investments not every application receives the advantage of using this type of motor drives. The main drawback of induction motors is the fact that they need slipcaused and thus loss-generating current in the rotor, and additional stator current for magnetic field production along with the torque-producing current. This can reduce the electric motor drive efficiency, especially in low-speed, low-power applications. Often, when high torque density is required together with low losses, it is desirable to apply permanent magnet technology, because in this case there is no need to use current to produce the basic excitation of the machine. This promotes the effectiveness of copper use in the stator, and further, there is no rotor current in these machines. Again, if permanent magnets with a high remanent flux density are used, the air gap flux density can be higher than in conventional induction motors. These advantages have raised the popularity of PMSMs in some challenging applications, such as hybrid electric vehicles (HEV), wind turbines, and home appliances. Usually, a correctly designed PMSM has a higher efficiency and consequently lower losses than its induction machine counterparts. Therefore, the use of these electrical machines reduces the energy consumption of the whole system to some extent, which can provide good motivation to apply permanent magnet technology to electrical machines. However, the cost of high performance rare earth permanent magnets in these machines may not be affordable in many industrial applications, because the tight competition between the manufacturers dictates the rules of low-cost and highly robust solutions, where asynchronous machines seem to be more feasible at the moment. Two main electromagnetic components of an electrical machine are the stator and the rotor. In the case of a conventional radial flux PMSM, the stator contains magnetic circuit lamination and stator winding, and the rotor consists of rotor steel (laminated or solid) and permanent magnets. The lamination itself does not significantly influence the total cost of the machine, even though it can considerably increase the construction complexity, as it requires a special assembly arrangement. However, thin metal sheet processing methods are very effective and economically feasible. Therefore, the cost of the machine is mainly affected by the stator winding and the permanent magnets. The work proposed in this doctoral dissertation comprises a description and analysis of two approaches of PMSM cost reduction: one on the rotor side and the other on the stator side. The first approach on the rotor side includes the use of low-cost and abundant ferrite magnets together with a tooth-coil winding topology and an outer rotor construction. The second approach on the stator side exploits the use of a modular stator structure instead of a monolithic one. PMSMs with the proposed structures were thoroughly analysed by finite element method based tools (FEM). It was found out that by implementing the described principles, some favourable characteristics of the machine (mainly concerning the machine size) will inevitable be compromised. However, the main target of the proposed approaches is not to compete with conventional rare earth PMSMs, but to reduce the price at which they can be implemented in industrial applications, keeping their dimensions at the same level or lower than those of a typical electrical machine used in the industry at the moment. The measurement results of the prototypes show that the main performance characteristics of these machines are at an acceptable level. It is shown that with certain specific actions it is possible to achieve a desirable efficiency level of the machine with the proposed cost reduction methods.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
We compared the cost-benefit of two algorithms, recently proposed by the Centers for Disease Control and Prevention, USA, with the conventional one, the most appropriate for the diagnosis of hepatitis C virus (HCV) infection in the Brazilian population. Serum samples were obtained from 517 ELISA-positive or -inconclusive blood donors who had returned to Fundação Pró-Sangue/Hemocentro de São Paulo to confirm previous results. Algorithm A was based on signal-to-cut-off (s/co) ratio of ELISA anti-HCV samples that show s/co ratio ³95% concordance with immunoblot (IB) positivity. For algorithm B, reflex nucleic acid amplification testing by PCR was required for ELISA-positive or -inconclusive samples and IB for PCR-negative samples. For algorithm C, all positive or inconclusive ELISA samples were submitted to IB. We observed a similar rate of positive results with the three algorithms: 287, 287, and 285 for A, B, and C, respectively, and 283 were concordant with one another. Indeterminate results from algorithms A and C were elucidated by PCR (expanded algorithm) which detected two more positive samples. The estimated cost of algorithms A and B was US$21,299.39 and US$32,397.40, respectively, which were 43.5 and 14.0% more economic than C (US$37,673.79). The cost can vary according to the technique used. We conclude that both algorithms A and B are suitable for diagnosing HCV infection in the Brazilian population. Furthermore, algorithm A is the more practical and economical one since it requires supplemental tests for only 54% of the samples. Algorithm B provides early information about the presence of viremia.
Resumo:
A closed fracture was performed on the left tibia of 3-month-old Wistar rats weighing 250 to 350 g that were either healthy (N = 24) or made diabetic with alloxan (N = 24) to investigate the effect of alloxan-induced diabetes on the course of bone fracture healing. Histomorphometric analysis of the fracture site was performed at 7, 14, 25, and 35 days. After 7 days, diabetic rats had significantly less cartilage (P = 0.045) and greater fibrous connective (P = 0.006) tissue formation at the fracture site compared to controls. In contrast, marked callus formation was seen in diabetic rats with significant osteogenesis (P = 0.011, P = 0.010, P = 0.010, respectively, for 14, 25, and 35 days) and chondrogenesis (P = 0.028, P = 0.033, P = 0.019) compared to controls. Radiographic analysis revealed a displaced fracture with poor bone fragment alignment and delayed consolidation at these times in the diabetic group. The levels of alkaline phosphatase were significantly higher in diabetic rats at 25 days (P = 0.009). These results suggest that the initial excessive formation of fibrous connective tissue associated with delay in chondrogenesis and osteogenesis may not provide suitable stability of the fractured site, contributing to the inappropriate alignment of fragments and an increase in the volume of callus in later stages of repair. The resulting displaced fracture in diabetic rats requires long periods for remodeling and complete bone consolidation.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.
Resumo:
The aim of this study was to explore the clinical efficacy of a novel retrograde puncture approach to establish a preperitoneal space for laparoscopic direct inguinal hernia repair with inguinal ring suturing. Forty-two patients who underwent laparoscopic inguinal hernia repair with retrograde puncture for preperitoneal space establishment as well as inguinal ring suturing between August 2013 and March 2014 at our hospital were enrolled. Preperitoneal space was successfully established in all patients, with a mean establishment time of 6 min. Laparoscopic repairs were successful in all patients, with a mean surgical time of 26±15.1 min. Mean postoperative hospitalization duration was 3.0±0.7 days. Two patients suffered from postoperative local hematomas, which were relieved after puncturing and drainage. Four patients had short-term local pain. There were no cases of chronic pain. Patients were followed up for 6 months to 1 year, and no recurrence was observed. Our results demonstrate that preperitoneal space established by the retrograde puncture technique can be successfully used in adult laparoscopic hernioplasty to avoid intraoperative mesh fixation, and thus reduce medical costs.