964 resultados para RESTRICTION


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background Long-term treatment of primary HIV-1 infection (PHI) may allow the immune reconstitution of responses lost during the acute viremic phase and decrease of peripheral reservoirs. This in turn may represent the best setting for the use of therapeutic vaccines in order to lower the viral set-point or control of viral rebound upon ART discontinuation. Methods We investigated a cohort of 16 patients who started ART at PHI, with treatment duration of ≥4 years and persistent aviremia (<50 HIV-1 copies/ml). The cohort was characterized in terms of viral subtype, cell-associated RNA, proviral DNA and HLA genotype. Secretion of IFN-γ, IL-2 and TNF-α by CD8 T-cells was analysed by polychromatic flowcytometry using a panel of 192 HIV-1-derived epitopes. Results This cohort is highly homogenous in terms of viral subtype: 81% clade B. We identified 44 epitope-specific responses: all patients had detectable responses to >1 epitope and the mean number of responding epitopes per patient was 3. The mean frequency of cytokines-secreting CD8 T-cells was 0.32%. CD8 T-cells secreting simultaneously IFN-γ, IL-2 and TNF-α made up for about 40% of the response and cells secreting at least 2 cytokines for about 80%, consistent with a highly polyfunctional CD8 T-cell profile. There was no difference in term of polyfunctionality when HLA restriction, or recognized viral regions and epitopes were considered. Proviral DNA was detectable in all patients but at low levels (mean = 108 copies/1 million PBMCs) while cell-associated mRNA was not detectable in 19% of patients (mean = 11 copies/1 million PBMCs when detectable). Conclusion Patients with sustained virological suppression after initiation of ART at PHI show polyfunctional CD8 T-cell and low levels of proviral DNA with an absence of residual replication in a substantial percentage of patients. The use of therapeutic vaccines in this population may promote low level of rebound viremia or control of viral replication upon ART cessation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The bacterial insertion sequence IS21 when repeated in tandem efficiently promotes non-replicative cointegrate formation in Escherichia coli. An IS21-IS21 junction region which had been engineered to contain unique SalI and BglII sites close to the IS21 termini was not affected in the ability to form cointegrates with target plasmids. Based on this finding, a novel procedure of random linker insertion mutagenesis was devised. Suicide plasmids containing the engineered junction region (pME5 and pME6) formed cointegrates with target plasmids in an E.coli host strain expressing the IS21 transposition proteins in trans. Cointegrates were resolved in vitro by restriction with SalI or BglII and ligation; thus, insertions of four or 11 codons, respectively, were created in the target DNA, practically at random. The cloned Pseudomonas aeruginosa arcB gene encoding catabolic ornithine carbamoyltransferase was used as a target. Of 20 different four-codon insertions in arcB, 11 inactivated the enzyme. Among the remaining nine insertion mutants which retained enzyme activity, three enzyme variants had reduced affinity for the substrate ornithine and one had lost recognition of the allosteric activator AMP. The linker insertions obtained illustrate the usefulness of the method in the analysis of structure-function relationships of proteins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Soil pollution with hexachlorocyclohexane (HCH) has caused serious environmental problems. Here we describe the targeted degradation of all HCH isomers by applying the aerobic bacterium Sphingobium indicum B90A. In particular, we examined possibilities for large-scale cultivation of strain B90A, tested immobilization, storage and inoculation procedures, and determined the survival and HCH-degradation activity of inoculated cells in soil. Optimal growth of strain B90A was achieved in glucose-containing mineral medium and up to 65% culturability could be maintained after 60 days storage at 30 degrees C by mixing cells with sterile dry corncob powder. B90A biomass produced in water supplemented with sugarcane molasses and immobilized on corncob powder retained 15-20% culturability after 30 days storage at 30 degrees C, whereas full culturability was maintained when cells were stored frozen at -20 degrees C. On the contrary, cells stored on corncob degraded gamma-HCH faster than those that had been stored frozen, with between 15 and 85% of gamma-HCH disappearance in microcosms within 20 h at 30 degrees C. Soil microcosm tests at 25 degrees C confirmed complete mineralization of [(14)C]-gamma-HCH by corncob-immobilized strain B90A. Experiments conducted in small pits and at an HCH-contaminated agricultural site resulted in between 85 and 95% HCH degradation by strain B90A applied via corncob, depending on the type of HCH isomer and even at residual HCH concentrations. Up to 20% of the inoculated B90A cells survived under field conditions after 8 days and could be traced among other soil microorganisms by a combination of natural antibiotic resistance properties, unique pigmentation and PCR amplification of the linA genes. Neither the addition of corncob nor of corncob immobilized B90A did measurably change the microbial community structure as determined by T-RFLP analysis. Overall, these results indicate that on-site aerobic bioremediation of HCH exploiting the biodegradation activity of S. indicum B90A cells stored on corncob powder is a promising technology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background:Intrauterine growth restriction (IUGR) is a major risk factor for both perinatal and long-term morbidity. Bovine lactoferrin (bLf) is a major milk glycoprotein considered as a pleiotropic functional nutrient. The impact of maternal supplementation with bLf on IUGR-induced sequelae, including inadequate growth and altered cerebral development, remains unknown.Methods:IUGR was induced through maternal dexamethasone infusion (100 μg/kg during last gestational week) in rats. Maternal supplementation with bLf (0.85% in food pellet) was provided during both gestation and lactation. Pup growth was monitored, and Pup brain metabolism and gene expression were studied using in vivo (1)H NMR spectroscopy, quantitative PCR, and microarray in the hippocampus at postnatal day (PND)7.Results:Maternal bLf supplementation did not change gestational weight but increased the birth body weight of control pups (4%) with no effect on the IUGR pups. Maternal bLf supplementation allowed IUGR pups to recover a normalized weight at PND21 (weaning) improving catch-up growth. Significantly altered levels of brain metabolites (γ-aminobutyric acid, glutamate, N-acetylaspartate, and N-acetylaspartylglutamate) and transcripts (brain-derived neurotrophic factor (BDNF), divalent metal transporter 1 (DMT-1), and glutamate receptors) in IUGR pups were normalized with maternal bLf supplementation.Conclusion:Our data suggest that maternal bLf supplementation is a beneficial nutritional intervention able to revert some of the IUGR-induced sequelae, including brain hippocampal changes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Salicylate is a precursor of pyochelin in Pseudomonas aeruginosa and both compounds display siderophore activity. To elucidate the salicylate biosynthetic pathway, we have cloned and sequenced a chromosomal region of P. aeruginosa PAO1 containing two adjacent genes, designated pchB and pchA, which are necessary for salicylate formation. The pchA gene encodes a protein of 52 kDa with extensive similarity to the chorismate-utilizing enzymes isochorismate synthase, anthranilate synthase (component I) and p-aminobenzoate synthase (component I), whereas the 11 kDa protein encoded by pchB does not show significant similarity with other proteins. The pchB stop codon overlaps the presumed pchA start codon. Expression of the pchA gene in P. aeruginosa appears to depend on the transcription and translation of the upstream pchB gene. The pchBA genes are the first salicylate biosynthetic genes to be reported. Salicylate formation was demonstrated in an Escherichia coli entC mutant lacking isochorismate synthase when this strain expressed both the pchBA genes, but not when it expressed pchB alone. By contrast, an entB mutant of E. coli blocked in the conversion of isochorismate to 2,3-dihydro-2,3-dihydroxybenzoate formed salicylate when transformed with a pchB expression construct. Salicylate formation could also be demonstrated in vitro when chorismate was incubated with a crude extract of P. aeruginosa containing overproduced PchA and PchB proteins; salicylate and pyruvate were formed in equimolar amounts. Furthermore, salicylate-forming activity could be detected in extracts from a P. aeruginosa pyoverdin-negative mutant when grown under iron limitation, but not with iron excess. Our results are consistent with a pathway leading from chorismate to isochorismate and then to salicylate plus pyruvate, catalyzed consecutively by the iron-repressible PchA and PchB proteins in P. aeruginosa.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Female-specific expression of the Xenopus laevis vitellogenin gene was reconstituted in vitro by addition of recombinant vaccinia-virus-produced estrogen receptor to nuclear extracts from male livers, in which this gene is silent. Transcription enhancement was at least 30 times and was selectively restricted to vitellogenin templates containing the estrogen-responsive unit. Thus, in male hepatocytes, estrogen receptor is the limiting regulatory factor that in the female liver controls efficient and accurate sex-specific expression of the vitellogenin gene. Furthermore, the Xenopus liver factor B, which is essential in addition to the estrogen receptor for the activation of this gene, was successfully replaced in the Xenopus extract by purified human nuclear factor I, identifying factor B of Xenopus as a functional homolog of this well-characterized human transcription factor.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dans les cellules épithéliales sensibles à l'aldostérone, le canal sodique épithélial (ENaC) joue un rôle critique dans le contrôle de l'équilibre sodique, le volume sanguin, et la pression sanguine. Le rôle d'ENaC est bien caractérisé dans le rein et les poumons, cependant le rôle d'ENaC et son régulateur positif la protéase activatrice de canal 1 (CAP1 /Prss8) sur le transport sodique dans le côlon reste en grande partie inconnu. Nous avons étudié l'importance d'ENaC et de CAPMPrss8 dans le côlon. Les souris déficientes pour la sous- unité aENaC (souris ScnnlaKO) dans les cellules superficielles intestinales étaient viables et ne montraient pas de létalité embryonnaire ou postnatale. Sous diète normale (RS) ou pauvre en sodium (LS), la différence de potentiel rectale sensible à l'amiloride (APDamii) était drastiquement diminuée et son rythme circadien atténué. Sous diète normale (RS) ou diète riche en sodium (HS) ou fort chargement de potassium, le sodium et le potassium plasmatique et urinaire n'étaient pas significativement changé. Cependant, sous LS, les souris Senni aK0 perdaient des quantités significativement augmentées de sodium dans leurs fèces, accompagnées par de très hauts taux d'aldostérone plasmatique et une rétention urinaire en sodium augmentée. Les souris déficientes en CAPl/PmS (Prss8K0) dans les cellules superficielles intestinales étaient viables et ne montraient pas de létalité embryonnaire ou postnatale. Sous diètes RS et HS cependant, les souris Prss8KO montraient une diminution significative du APDamil dans l'après-midi, mais le rythme circadien était maintenu. Sous diète LS, la perte de sodium par les fèces était accompagnée par des niveaux d'aldostérone plasmatiques plus élevés. Par conséquent, nous avons identifié la protéase activatrice de canal CAP 1 IPrss8 comme un régulateur important d'ENaC dans le côlon in vivo. De plus, nous étudions l'importance d'ENaC et de CAPIIPrss8 dans les conditions pathologiques comme les maladies inflammatoires chroniques de l'intestin (MICI). Le résultat préliminaire out montre qu'une déficience d'Prss8 mènait à la détérioration de la colite induite par le DSS comparé aux modèles contrôles respectifs. En résumé, l'étude a montré que sous restriction de sel, l'absence d'ENaC dans Pépithélium de surface du côlon était compensée par 1'activation du système rénine-angiotensine- aldostérone (RAAS) dans le rein. Ceci a mené à un pseudohypoaldostéronisme de type I spécifique au côlon avec résistance aux minéralocorticoïdes sans signe d'altération de rétention de potassium. - In aldosterone-responsive epithelial cells of kidney and colon, the epithelial sodium channel (ENaC) plays a critical role in the control of sodium balance, blood volume, and blood pressure. The role of ENaC is well characterized in kidney and lung, whereas role of ENaC and its positive regulator channel-activating protease 1 (CAPl/PrasS) on sodium transport in colon is largely unknown. We have investigated the importance of ENaC and CAPI/Prss8 in colon for sodium and potassium balance. Mice lacking the aENaC subunit (Scnnla mice) in intestinal superficial cells were viable and did not show any fetal or perinatal lethality. Under regular (RS) or low salt (LS) diet, the amiloride sensitive rectal potential difference (APDamii) was drastically decreased and its circadian rhythm blunted. Under regular salt (RS) or high salt (HS) diets or under potassium loading, plasma and urinary sodium and potassium were not significantly changed. However, upon LS, the ScnnlaK0 mice lost significant amounts of sodium in their feces, accompanied by very high plasma aldosterone and increased urinary sodium retention. Mice lacking the CAPl/PrasS (Prss8K0) in intestinal superficial cells were viable and did not show any fetal or perinatal lethality. Upon RS and HS diets, however, Prss8K0 exhibited a significantly reduced APDamii in the afternoon, but its circadian rhythm was maintained. Upon LS diet, sodium loss through feces was accompanied by higher plasma aldosterone levels. Thus, we have identified the channel-activating protease CAPl/Prss8 as an important in vivo regulator of ENaC in colon. Furthermore, we are investigating the importance of ENaC and CAPI/Prss8 in pathological conditions like inflammatory bowel disease (IBD). Preliminary data showed that PmS-deficiency led to worsening of DSS-induced colitis as compared to their respective controls. Overall, the present study has shown that under salt restriction, the absence of ENaC in colonic surface epithelium was compensated by the activation of renin-angiotensin- aldosterone (RAAS) system in the kidney. This led to a colon specific pseudohypoaldosteroni sm type 1 with mineralocorticoid resistance without evidence of impaired potassium retention.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The metabolic balance method was performed on three men to investigate the fate of large excesses of carbohydrate. Glycogen stores, which were first depleted by diet (3 d, 8.35 +/- 0.27 MJ [1994 +/- 65 kcal] decreasing to 5.70 +/- 1.03 MJ [1361 +/- 247 kcal], 15% protein, 75% fat, 10% carbohydrate) and exercise, were repleted during 7 d carbohydrate overfeeding (11% protein, 3% fat, and 86% carbohydrate) providing 15.25 +/- 1.10 MJ (3642 +/- 263 kcal) on the first day, increasing progressively to 20.64 +/- 1.30 MJ (4930 +/- 311 kcal) on the last day of overfeeding. Glycogen depletion was again accomplished with 2 d of carbohydrate restriction (2.52 MJ/d [602 kcal/d], 85% protein, and 15% fat). Glycogen storage capacity in man is approximately 15 g/kg body weight and can accommodate a gain of approximately 500 g before net lipid synthesis contributes to increasing body fat mass. When the glycogen stores are saturated, massive intakes of carbohydrate are disposed of by high carbohydrate-oxidation rates and substantial de novo lipid synthesis (150 g lipid/d using approximately 475 g CHO/d) without postabsorptive hyperglycemia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to evaluate the genetic diversity, its organization and the genetic relationships within oil palm (Elaeis oleifera (Kunth) Cortés, from America, and E. guineensis (Jacq.), from Africa) germplasm using Restriction Fragment Length Polymorphism (RFLP) and Amplified Fragment Length Polymorphism (AFLP). In complement to a previous RFLP study on 241 E. oleifera accessions, 38 E. guineensis accessions were analyzed using the same 37 cDNA probes. These accessions covered a large part of the geographical distribution areas of these species in America and Africa. In addition, AFLP analysis was performed on a sub-set of 40 accessions of E. oleifera and 22 of E. guineensis using three pairs of enzyme/primer combinations. Data were subjected to Factorial Analysis of Correspondence (FAC) and cluster analysis, with parameters of genetic diversity being also studied. Results appeared congruent between RFLP and AFLP. In the E. oleifera, AFLP confirmed the strong structure of genetic diversity revealed by RFLP, according to geographical origin of the studied material, with the identification of the same four distinct genetic groups: Brazil, French Guyana/Surinam, Peru, north of Colombia/Central America. Both markers revealed that genetic divergence between the two species is of the same magnitude as that among provenances of E. oleifera. This finding is in discrepancy with the supposed early tertiary separation of the two species.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The IncP alpha promiscuous plasmid (R18, R68, RK2, RP1 and RP4) comprises 60,099 bp of nucleotide sequence, encoding at least 74 genes. About 40 kb of the genome, designated the IncP core and including all essential replication and transfer functions, can be aligned with equivalent sequences in the IncP beta plasmid R751. The compiled IncP alpha sequence revealed several previously unidentified reading frames that are potential genes. IncP alpha plasmids carry genetic information very efficiently: the coding sequences of the genes are closely packed but rarely overlap, and occupy almost 86% of the genome's nucleotide sequence. All of the 74 genes should be expressed, although there is as yet experimental evidence for expression of only 60 of them. Six examples of tandem-in-frame initiation sites specifying two gene products each are known. Two overlapping gene arrangements occupy different reading frames of the same region. Intergenic regions include most of the 25 promoters; transcripts are usually polycistronic. Translation of most of the open reading frames seems to be initiated independently, each from its own ribosomal binding and initiation site, although, a few cases of coupled translation have been reported. The most frequently used initiation codon is AUG but translation for a few open reading frames begins at GUG or UUG. The most common stop-codon is UGA followed by UAA and then UAG. Regulatory circuits are complex and largely dependent on two components of the central control operon. KorA and KorB are transcriptional repressors controlling at least seven operons. KorA and KorB act synergistically in several cases by recognizing and binding to conserved nucleotide sequences. Twelve KorB binding sites were found around the IncP alpha sequence and these are conserved in R751 (IncP beta) with respect to both sequence and location. Replication of IncP alpha plasmids requires oriV and the plasmid-encoded initiator protein TrfA in combination with the host-encoded replication machinery. Conjugative plasmid transfer depends on two separate regions occupying about half of the genome. The primary segregational stability system designated Par/Mrs consists of a putative site-specific recombinase, a possible partitioning apparatus and a post-segregational lethality mechanism, all encoded in two divergent operons. Proteins related to the products of F sop and P1 par partitioning genes are separately encoded in the central control operon.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The ability of a PCR-based restriction fragment length polymorphism (RFLP) analysis of the cytochrome b (mtDNA) to distinguish Apodemus alpicola from two other Apodemus species was investigated. The partial sequencing of the cytochrome b allowed the identification of one enzyme as being potentially diagnostic. This was supported by an analysis of 131 specimens previously identified using morphometric and/or allozymic data, indicating that the PCR-based RFLP method provides a rapid and reliable tool for distinguishing A. alpicola from its two co-occurring congenerics. The method is applicable to samples taken in the field for ecological studies, and could easily be adapted to the identification of museum samples.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O objetivo deste trabalho foi caracterizar geneticamente sete estirpes de rizóbios nativos dos tabuleiros costeiros de Sergipe com alta eficiência de fixação biológica do N2 em associação com guandu (Cajanus cajan) e caupi (Vigna unguiculata). A amplificação do DNA pela técnica de PCR (polymerase chain reaction) com o oligonucleotídeo específico BOX indicou um grau elevado de diversidade genética, uma vez que todas as estirpes apresentaram perfis únicos de DNA. A análise por BOX-PCR revelou, ainda, que essa metodologia é eficiente para diferenciar estirpes, mas não para a diferenciação de espécies de rizóbio. Pela técnica do RFLP (restriction fragment length polymorphism) da região do DNA que codifica o gene 16S rRNA e da região intergênica entre os genes 16S e 23S rRNA, com cinco enzimas de restrição, bem como pelo seqüenciamento parcial da região do 16S rRNA, foi possível classificar as estirpes nos gêneros Bradyrhizobium e Rhizobium. Houve coerência entre as análises envolvendo a região do 16S rRNA, mas o agrupamento com uma das estirpes diferiu pela análise do espaço intergênico. Os resultados obtidos com a estirpe R11 indicam variabilidade genética elevada em relação às espécies de rizóbios descritas, inclusive diferindo em diversas bases da região do 16S rRNA, e podem indicar uma nova espécie.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this investigation, high-resolution, 1x1x1-mm(3) functional magnetic resonance imaging (fMRI) at 7 T is performed using a multichannel array head coil and a surface coil approach. Scan geometry was optimized for each coil separately to exploit the strengths of both coils. Acquisitions with the surface coil focused on partial brain coverage, while whole-brain coverage fMRI experiments were performed with the array head coil. BOLD sensitivity in the occipital lobe was found to be higher with the surface coil than with the head array, suggesting that restriction of signal detection to the area of interest may be beneficial for localized activation studies. Performing independent component analysis (ICA) decomposition of the fMRI data, we consistently detected BOLD signal changes and resting state networks. In the surface coil data, a small negative BOLD response could be detected in these resting state network areas. Also in the data acquired with the surface coil, two distinct components of the positive BOLD signal were consistently observed. These two components were tentatively assigned to tissue and venous signal changes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fungi are divided in 3 groups in the field of medical mycology. The dermatophytes are filamentous fungi able to grow on keratinized tissues from human or animals. They are the main cause of superficial and cutaneous mycoses of the skin and its appendix (hair and nail). The yeasts, or dimorphic fungi, can be responsible of diverse types of infections (superficial to deep mycoses). The moulds include all Non-dermatophyte Filamentous Fungi (NDF). In medical mycology, the most representative moulds are Aspergillus spp., Fusarium spp. and Mucor spp. Diagnosis of mycosis is currently based on direct mycological examination of biological samples, as well as macroscopic and microscopic identification of the infectious fungus in culture assay. However, culture assays were found to remain sterile in roughly 40% of cases otherwise positive by direct mycological examinations. Additionally, results from culture assays are often difficult to interpret as various NDF are sometimes isolated. This thesis work is composed of three projects focusing on the development of new assays for direct in situ identification of fungi from dermatological samples. Part 1. A Polymerase Chain Reaction - Terminal Restriction Fragment Length Polymorphism assay (PCR-TRFLP) targeting the 28S rDNA was developed to identify dermatophytes and NDF in nails with suspected onychomycosis. This method is faster and more efficient than culture. It further enables the distinction of more than one agent in case of mixed infection. A fast and reliable assay for the identification of dermatophytes and NDF in onychomycosis was found to be highly relevant since onychomycosis with Fusarium spp. or other NDF are weakly responsive or unresponsive to standard onychomycosis treatments with oral terbinafine and itraconazole. Part 2. A nested PCR-sequencing assay targeting the 28S rDNA was developed to identify dermatophyte species in skin and hair samples. This method is especially suitable for tinea capitis where dermatophytes identification is critical for subsequently prescribing the adequate treatment. The challenge presented when performing direct PCR fungi identification in skin and hair differs from that seen in onychomycosis as small amount of material is generally collected, few fungal elements are present in the clinical sample and one dermatophyte among a dozen species must be identified. Part 3. Fusarium spp. is currently isolated from nails with a frequency of 15% of that of dermatophytes in the laboratory of Mycology of the CHUV (2005-2012). The aim of this work was to examine if the intensive use of terbinafine and itraconazole could be a cause of the high incidence of Fusarium nail infections. For that purpose, two different methods, specific PCR and TRFLP, were used to detect both Fusarium spp. and Trichophyton spp. in nails of previously treated or untreated patients. TRFLP assay was found to be less sensitive than classical PCR assays specifically detecting Fusarium spp. or Trichophyton spp. Independently of the detection method used, the prevalence of Fusarium spp. appears not to be higher in patients previously treated by oral standard treatment with terbinafine and azoles which are highly effective to fight Trichophyton spp. in nails. In many cases Fusarium sp. was detected in samples of patients not previously subjected to antifungal therapy. Therefore, these treatments do not appear to favor the establishment of Fusarium spp. after elimination of a dermatophyte in nail infection. - En mycologie médicale, les champignons sont classés en 3 groupes. Les dermatophytes sont des champignons filamenteux capables de se développer dans les tissus kératinisés des hommes et des animaux, ils représentent la principale cause des mycoses superficielles et cutanées de la peau et de ses appendices (ongles et cheveux). Les levures, ou champignons dimorphiques, peuvent être responsables de divers types d'infections (superficielles à profondes). Les moisissures incluent tous les champignons filamenteux non-dermatophytes (NDF), les Aspergillus spp., les Fusarium spp. et les Mucor spp. sont les principales espèces rencontrées. Le diagnostic d'une mycose est basé sur un examen mycologique direct des prélèvements biologiques ainsi que sur l'identification macroscopique et microscopique du champignon infectieux isolé en culture. Cependant, dans environ 40% des cas, l'identification de l'agent pathogène est impossible par cette méthode car la culture reste stérile, bien que l'examen direct soit positif. De plus, la croissance de moisissures et/ou autres contaminants peut rendre l'interprétation de l'examen difficile. Ce travail de thèse est composé de trois projets focalisés sur le développement de nouvelles méthodes d'identification des champignons directement à partir d'échantillons dermatologiques. Projet 1. Une méthode de Réaction en chaîne de polymérase couplée à du polymorphisme de longueur des fragments de restriction terminaux (PCR-TRFLP), en ciblant l'ADN ribosomal 28S, a été développée pour l'identification des dermatophytes et moisissures dans les ongles avec suspicion d'onychomycoses. Cette technique s'est avérée plus rapide et plus efficace que la culture, permettant l'identification de plusieurs champignons en même temps. Posséder une méthode d'identification rapide et fiable des dermatophytes et des NDF dans les onychomycoses a été jugée nécessaire du fait que les Fusarium et d'autres NDF sont peu ou pas sensibles aux traitements oraux standards à la terbinafine et à Γ itraconazole. Projet 2. Une PCR nichée couplée au séquençage d'un fragment de l'ADN ribosomal 28S a été développée afin de différencier les dermatophytes dans la peau et les cheveux. Cette méthode est particulièrement adaptée au cas de tinea capitis, où l'identification du dermatophyte est essentielle afin de prescrire le traitement adéquat. Le problème de l'identification du pathogène fongique dans les cheveux et la peau diffère des onychomycoses car de petites quantités sont prélevées chez les patients, peu d'éléments fongiques sont présents et il faut discriminer un dermatophyte parmi une douzaine d'espèces potentielles. Projet 3. Au laboratoire de Mycologie du CHUV, les Fusarium ont été isolé dans les ongles à une fréquence de 15% pour la période 2005-2012. Le but de ce travail était d'examiner si l'utilisation intensive de terbinafine et d'itraconazole pouvait être une des causes de la forte incidence des infections des ongles par Fusarium. A cet effet, deux méthodes ont été utilisées pour détecter à la fois Fusarium spp. et Trichophyton spp., la PCR spécifique et le TRFLP. Indépendamment de la méthode choisie, il en résulte que la prévalence des Fusarium η'apparaît pas liée à un traitement au préalable des patients avec de la terbinafine ou des azoles, thérapies très efficaces contre les Trichophyton spp. dans les ongles. De plus, il existe de nombreux cas où Fusarium était détecté chez des patients non traités.