967 resultados para DNA Sequences


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The penicillin biosynthetic genes (pcbAB, pcbC, penDE) of Penicillium chrysogenum AS-P-78 were located in a 106.5-kb DNA region that is amplified in tandem repeats (five or six copies) linked by conserved TTTACA sequences. The wild-type strains P. chrysogenum NRRL 1951 and Penicillium notatum ATCC 9478 (Fleming's isolate) contain a single copy of the 106.5-kb region. This region was bordered by the same TTTACA hexanucleotide found between tandem repeats in strain AS-P-78. A penicillin overproducer strain, P. chrysogenum E1, contains a large number of copies in tandem of a 57.9-kb DNA fragment, linked by the same hexanucleotide or its reverse complementary TGTAAA sequence. The deletion mutant P. chrysogenum npe10 showed a deletion of 57.9 kb that corresponds exactly to the DNA fragment that is amplified in E1. The conserved hexanucleotide sequence was reconstituted at the deletion site. The amplification has occurred within a single chromosome (chromosome I). The tandem reiteration and deletion appear to arise by mutation-induced site-specific recombination at the conserved hexanucleotide sequences.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Elevated expression of the marORAB multiple antibiotic-resistance operon enhances the resistance of Escherichia coli to various medically significant antibiotics. Transcription of the operon is repressed in vivo by the marR-encoded protein, MarR, and derepressed by salicylate and certain antibiotics. The possibility that repression results from MarR interacting with the marO operator-promoter region was studied in vitro using purified MarR and a DNA fragment containing marO. MarR formed at least two complexes with marO DNA, bound > 30-fold more tightly to it than to salmon sperm DNA, and protected two separate 21-bp sites within marO from digestion by DNase I. Site I abuts the downstream side of the putative -35 transcription-start signal and includes 4 bp of the -10 signal. Site II begins 13 bp downstream of site I, ending immediately before the first base pair of marR. Site II, approximately 80% homologous to site I, is not required for repression since a site II-deleted mutant (marO133) was repressed in trans by wild-type MarR. The absence of site II did not prevent MarR from complexing with the site I of marO133. Salicylate bound to MarR (Kd approximately 0.5 mM) and weakened the interaction of MarR with sites I and II. Thus, repression of the mar operon, which curbs the antibiotic resistance of E. coli, correlates with the formation of MarR-site I complexes. Salicylate appears to induce the mar operon by binding to MarR and inhibiting complex formation, whereas tetracycline and chloramphenicol, which neither bind MarR nor inhibit complex formation, must induce by an indirect mechanism.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

B-lymphocyte-specific class switch recombination is known to occur between pairs of 2- to 10-kb switch regions located immediately upstream of the immunoglobulin constant heavy-chain genes. Others have shown that the recombination is temporally correlated with the induction of transcription at the targeted switch regions. To determine whether this temporal correlation is due to a mechanistic linkage, we have developed an extrachromosomal recombination assay that closely recapitulates DNA deletional class switch recombination. In this assay, the rate of recombination is measured between 24 and 48 hr posttransfection. We find that recombinants are generated in a switch sequence-dependent manner. Recombination occurs with a predominance within B-cell lines representative of the mature B-cell stage and within a subset of pre-B-cell lines. Transcription stimulates the switch sequence-dependent recombination. Importantly, transcription activates recombination only when directed in the physiologic orientation but has no effect when directed in the nonphysiologic orientation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recombinant antibodies capable of sequence-specific interactions with nucleic acids represent a class of DNA- and RNA-binding proteins with potential for broad application in basic research and medicine. We describe the rational design of a DNA-binding antibody, Fab-Ebox, by replacing a variable segment of the immunoglobulin heavy chain with a 17-amino acid domain derived from TFEB, a class B basic helix-loop-helix protein. DNA-binding activity was studied by electrophoretic mobility-shift assays in which Fab-Ebox was shown to form a specific complex with DNA containing the TFEB recognition motif (CACGTG). Similarities were found in the abilities of TFEB and Fab-Ebox to discriminate between oligodeoxyribonucleotides containing altered recognition sequences. Comparable interference of binding by methylation of cytosine residues indicated that Fab-Ebox and TFEB both contact DNA through interactions along the major groove of double-stranded DNA. The results of this study indicate that DNA-binding antibodies of high specificity can be developed by using the modular nature of both immunoglobulins and transcription factors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To classify Listeria monocytogenes using taxonomic characters derived from the rRNA operons and their flanking sequences, we studied a sample of 1346 strains within the taxon. DNA from each strain was digested with a restriction endonuclease, EcoRI. The fragments were separated by gel electrophoresis, immobilized on a membrane, and hybridized with a labeled rRNA operon from Escherichia coli. The pattern of bands, positions, and intensities of hybridized fragments were electronically captured. Software was used to normalize the band positions relative to standards, scale the signal intensity, and reduce the background so that each strain was reproducibly represented in a data base as a pattern. With these methods, L. monocytogenes was resolved into 50 pattern types differing in the length of at least one polymorphic fragment. Pattern types representing multiple strains were recorded as the mathematical average of the strain patterns. Pattern types were arranged by size polymorphisms of assigned rRNA regions into subsets, which revealed the branching genetic structure of the species. Subtracting the polymorphic variants of a specific assigned region from the pattern types and averaging the types within each subset resulted in reduced sets of conserved fragments that could be used to recognize strains of the species. Pattern types and reduced sets of conserved fragments were conserved among different strains of L. monocytogenes but were not observed in total among strains of other species.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

By using taxonomic characters derived from EcoRI restriction endonuclease digestion of genomic DNA and hybridization with a labeled rRNA operon from Escherichia coli, a polymorphic structure of Listeria monocytogenes, characterized by fragments with different frequencies of occurrence, was observed. This structure was expanded by creating predicted patterns through a recursive process of observation, expectation, prediction, and assessment of completeness. This process was applied, in turn, to normalized strain patterns, fragment bands, and positions of EcoRI recognition sites relative to rRNA regions. Analysis of 1346 strains provided observed patterns, fragment sizes, and their frequencies of occurrence in the patterns. Fragment size statistics led to the creation of unobserved combinations of bands, predicted pattern types. The observed fragment bands revealed positions of EcoRI sites relative to rRNA sequences. Each EcoRI site had a frequency of occurrence, and unobserved fragment sizes were postulated on the basis of knowing the restriction site locations. The result of the recursion process applied to the components of the strain data was an extended classification with observed and predicted members.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We describe a procedure for preferential isolation of DNA fragments with G+C-rich portions. Such fragments occur in known genes within or adjacent to CpG islands. Since about 56% of human genes are associated with CpG islands, isolation of these fragments permits detection and probing of many genes within much larger segments of DNA, such as cosmids or yeast artificial chromosomes, which have not been sequenced. Cloned DNA fragments digested with four restriction endonucleases were subjected to denaturing gradient gel electrophoresis. Long G+C-rich sections in fragments inhibit strand dissociation after the fragments reach retardation level in the gradient; such fragments are retained in the gel after most others disappear. Nucleotide sequences of the retained fragments show that about half of these fragments appear to be derived from CpG islands. Northern analysis indicated the presence of RNA complementary to most of the retained fragments. A heuristic approach to the relation between base sequence and the kinetics of strand dissociation of partly melted molecules appears to account for retention and nonretention. The expectation that CpG island fragments will be enriched among fragments retained in a denaturing gradient is supported by rate estimates based on melting theory applied to known sequences. This method, designated SPM for segregation of partly melted molecules, is expected to provide a means for convenient and efficient isolation of genes from unsequenced DNA.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Juvenile loggerhead turtles (Caretta caretta) have recently been documented in the vicinity of Baja California and thousands of these animals have been captured in oceanic fisheries of the North Pacific. The presence of loggerhead turtles in the central and eastern North Pacific is a prominent enigma in marine turtle distribution because the nearest documented nesting concentrations for this species are in Australia and Japan, over 10,000 km from Baja California. To determine the origin of the Baja California feeding aggregate and North Pacific fishery mortalities, samples from nesting areas and pelagic feeding aggregates were compared with genetic markers derived from mtDNA control region sequences. Overall, 57 of 60 pelagic samples (95%) match haplotypes seen only in Japanese nesting areas, implicating Japan as the primary source of turtles in the North Pacific Current and around Baja California. Australian nesting colonies may contribute the remaining 5% of these pelagic feeding aggregates. Juvenile loggerhead turtles apparently traverse the entire Pacific Ocean, approximately one-third of the planet, in the course of developmental migrations, but mortality in high-seas fisheries raises concern over the future of this migratory population.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Oncogenic retroviruses carry coding sequences that are transduced from cellular protooncogenes. Natural transduction involves two nonhomologous recombinations and is thus extremely rare. Since transduction has never been reproduced experimentally, its mechanism has been studied in terms of two hypotheses: (i) the DNA model, which postulates two DNA recombinations, and (ii) the RNA model, which postulates a 5' DNA recombination and a 3' RNA recombination occurring during reverse transcription of viral and protooncogene RNA. Here we use two viral DNA constructs to test the prediction of the DNA model that the 3' DNA recombination is achieved by conventional integration of a retroviral DNA 3' of the chromosomal protooncogene coding region. For the DNA model to be viable, such recombinant viruses must be infectious without the purportedly essential polypurine tract (ppt) that precedes the 3' long terminal repeat (LTR) of all retroviruses. Our constructs consist of a ras coding region from Harvey sarcoma virus which is naturally linked at the 5' end to a retroviral LTR and artificially linked at the 3' end either directly (construct NdN) or by a cellular sequence (construct SU) to the 5' LTR of a retrovirus. Both constructs lack the ppt, and the LTR of NdN even lacks 30 nucleotides at the 5' end. Both constructs proved to be infectious, producing viruses at titers of 10(5) focus-forming units per ml. Sequence analysis proved that both viruses were colinear with input DNAs and that NdN virus lacked a ppt and the 5' 30 nucleotides of the LTR. The results indicate that DNA recombination is sufficient for retroviral transduction and that neither the ppt nor the complete LTR is essential for retrovirus replication. DNA recombination explains the following observations by others that cannot be reconciled with the RNA model: (i) experimental transduction is independent of the packaging efficiency of viral RNA, and (ii) experimental transduction may invert sequences with respect to others, as expected for DNA recombination during transfection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GabR è un fattore di trascrizione chimerico appartenente alla famiglia dei MocR/GabR, costituito da un dominio N-terminale elica-giro-elica di legame al DNA e un dominio effettore e/o di oligomerizzazione al C-terminale. I due domini sono connessi da un linker flessibile di 29 aminoacidi. Il dominio C-terminale è strutturalmente omologo agli enzimi aminotransferasici fold-type I, i quali, utilizzando il piridossal-5’-fosfato (PLP) come cofattore, sono direttamente coinvolti nel metabolismo degli aminoacidi. L’interazione contemporanea di PLP e acido γ-aminobutirrico (GABA) a GabR fa sì che questa promuova la trascrizione di due geni, gabT e gabD, implicati nel metabolismo del GABA. GabR cristallizza come un omodimero con una configurazione testa-coda. Il legame con la regione promotrice gabTD avviene attraverso il riconoscimento specifico di due sequenze dirette e ripetute (ATACCA), separate da uno spacer di 34 bp. In questo studio sono state indagate le proprietà biochimiche, strutturali e di legame al DNA della proteina GabR di Bacillus subtilis. L’analisi spettroscopica dimostra che GabR interagisce con il PLP formando l’aldimina interna, mentre in presenza di GABA si ottiene l’aldimina esterna. L’interazione fra il promotore gabTD e le forme holo e apo di GabR è stata monitorata mediante Microscopia a Forza atomica (AFM). In queste due condizioni di legame è stata stimata una Kd di circa 40 ηM. La presenza di GABA invece, determinava un incremento di circa due volte della Kd, variazioni strutturali nei complessi GabR-DNA e una riduzione del compattamento del DNA alla proteina, indipendentemente dalla sequenza del promotore in esame. Al fine di valutare il ruolo delle caratteristiche topologiche del promotore, sono state inserite cinque e dieci bp all’interno della regione spacer che separa le due sequenze ripetute dirette riconosciute da GabR. I significativi cambiamenti topologici riscontrati nel frammento aggiunto di cinque bp si riflettono anche sulla forte riduzione dell’affinità di legame verso la proteina. Al contrario, l’inserzione di 10 bp provoca solamente l’allontanamento delle sequenze ripetute dirette. L’assenza quindi di cambiamenti significativi nella topologia di questo promotore fa sì che l’affinità di legame per GabR rimanga pressoché inalterata rispetto al promotore non mutato. L’analisi del potenziale elettrostatico superficiale di GabR mostra la presenza di una fascia carica positivamente che si estende lungo un’intera faccia della proteina. Per verificare l’importanza di questa caratteristica di GabR nel meccanismo di interazione al DNA, sono stati preparati ed indagati i mutanti R129Q e K362-366Q, in cui la carica positiva superficiale risultava indebolita. L’affinità di legame dei mutanti di GabR per il DNA era inferiore rispetto alla proteina non mutata, in particolar modo nel mutante K362-366Q. Le evidenze acquisite suggeriscono che la curvatura intrinseca del promotore ed il corretto orientamento delle sequenze sulla doppia elica, più della distanza che le separa, siano critici per sostenere l’interazione con GabR. Oltre a questo, la superficie positiva di GabR è richiesta per accomodare la curvatura del DNA sul corpo della proteina. Alla luce di questo, l’interazione GabR-gabTD è un esempio di come il riconoscimento specifico di sequenze, la topologia del DNA e le caratteristiche strutturali della proteina siano contemporaneamente necessarie per sostenere un’interazione proteina-DNA stabile.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal 'short-term stress memory' with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Macrophages and B cells are activated by unmethylated CpG-containing sequences in bacterial DNA. The lack of activity of self DNA has generally been attributed to CpG suppression and methylation, although the role of methylation is in doubt. The frequency of CpG in the mouse genome is 12.5% of Escherichia coli, with unmethylated CpG occurring at similar to3% the frequency of E. coli. This suppression of CpG alone is insufficient to explain the inactivity of self DNA; vertebrate DNA was inactive at 100 mug/ml, 3000 times the concentration at which E. coli DNA activity was observed. We sought to resolve why self DNA does not activate macrophages. Known active CpG motifs occurred in the mouse genome at 18% of random occurrence, similar to general CpG suppression. To examine the contribution of methylation, genomic DNAs were PCR amplified. Removal of methylation from the mouse genome revealed activity that was 23-fold lower than E. coli DNA, although there is only a 7-fold lower frequency of known active CpG motifs in the mouse genome. This discrepancy may be explained by G-rich sequences such as GGAGGGG, which potently inhibited activation and are found in greater frequency in the mouse than the E. coli genome. In summary, general CpG suppression, CpG methylation, inhibitory motifs, and saturable DNA uptake combined to explain the inactivity of self DNA. The immunostimulatory activity of DNA is determined by the frequency of unmethylated stimulatory sequences within an individual DNA strand and the ratio of stimulatory to inhibitory sequences.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sugarcane moth borers are a diverse group of species occurring in several genera, but predominately within the Noctuidae and Pyraloidea. They cause economic loss in sugarcane and other crops through damage to stems and stalks by larval boring. Partial sequence data from two mitochondrial genes, COII and 16S, were used to construct a molecular phylogeny based on 26 species from ten genera and six tribes. The Noctuidae were found to be monophyletic, providing molecular support for the taxonomy within this subfamily. However, the Pyraloidea are paraphyletic, with the noctuids splitting Galleriinae and Schoenobiinae from the Crambinae. This supports the separation of the Pyralidae and Crambinae, but does not support the concept of the incorporation of the Schoenobiinae in the Crambidae. Of the three crambine genera examined, Diatraea was monophyletic, Chilo paraphyletic, and Eoreuma was basal to the other two genera. Within the Noctuidae, Sesamia and Bathytricha were monophyletic, with Busseola basal to Bathytricha. Many species in this study (both noctuids and pyraloids) had different biotypes within collection localities and across their distribution; however the individual biotypes were not phylogenetically informative. These data highlight the need for taxonomic revisions at all taxon levels and provide a basis for the development of DNA-based diagnostics for rapidly identifying many species at any developmental stage. This ability is vital, as the species are an incursion threat to Australia and have the potential to cause significant losses to the sugar industry.