958 resultados para 290301 Robotics and Mechatronics
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Increasing water scarcity and depleted water productivity in irrigated soils are inducing farmers to adopt improved varieties, such as those with high-capacity tolerance. The use of tolerant varieties of sugarcane might substantially avoid the decline of productivity under water deficit. This research aimed to evaluate the harmful effects of drought on the physiology of two sugarcane varieties (RB867515 and RB962962) during the initial development. Young plants were subjected to irrigation suspension until total stomata closure, and then rewatered. Significant reduction on stomatal conductance, transpiration, and net photosynthesis were observed. RB867515 showed a faster stomatal closure while RB962962 slowed the effects of drought on the gas exchanges parameters with a faster recovering after rewatering. Accumulation of carbohydrates, amino acids, proline, and protein in the leaves and roots of the stressed plants occurred in both varieties, substantially linked to reduction of the leaf water potential. Due to the severity of stress, this accumulation was not enough to maintain the cell turgor pressure, so relative water content was diminished. Water stress affected the contents of chlorophyll (a, b, and total) in both varieties, but not the levels of carotenoids. There was a significant reduction in dry matter under stress. In conclusion, RB962962 variety endured stressed conditions more than RB867515, since it slowed down the damaging effects of drought on the gas exchanges. In addition, RB962962 presented a faster recovery than RB867515, a feature that qualifies it as a variety capable of enduring short periods of drought without major losses in the initial stage of its development.
Resumo:
Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.
Resumo:
Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.
Resumo:
OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8
Resumo:
Deficiency of the enzyme P450 oxidoreductase is a rare form of congenital adrenal hyperplasia with characteristics of combined and partial impairments in steroidogenic enzyme activities, as P450 oxidoreductase transfers electrons to CYP21A2, CYP17A1, and CYP19A1. It results in disorders of sex development and skeletal malformations similar to Antley-Bixley syndrome. We report the case of a 9-year-old girl who was born with virilized genitalia (Prader stage V), absence of palpable gonads, 46,XX karyotype, and hypergonadotropic hypogonadism. During the first year of life, ovarian cyst, partial adrenal insufficiency, and osteoarticular changes, such as mild craniosynostosis, carpal and tarsal synostosis, and limited forearm pronosupination were observed. Her mother presented severe virilization during pregnancy. The molecular analysis of P450 oxidoreductase gene revealed compound heterozygosis for the nonsense p.Arg223*, and the novel missense p.Met408Lys, inherited from the father and the mother, respectively. Arq Bras Endocrinol Metab. 2012;56(8):578-85
Resumo:
233
Resumo:
Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.
Resumo:
OBJECTIVE: The objective of this pilot study was to determine whether glugagon-like peptide 2 (GLP-2) secretion relates to insulin sensitivity (IS) in obese subjects. SUBJECTS AND METHODS: Twenty four obese subjects [body mass index (BMI) 40.0 ± 3.0 kg/m² (mean ± standard deviation)] were included, nine of which were male, age 43 ± 8 years. Twelve subjects had type 2 diabetes, all treated with oral anti-diabetic agents only. The subjects were submitted to standard meal tolerance test (MTT) for dosage of the curves: glucose, insulin, and GLP-2. Insulin sensitivity was measured by HOMA-IR, and OGIS was derived from the MTT. Spearman linear correlations and partial correlations were obtained. RESULTS: There was an inverse relationship between the GLP-2 secretion and IS: HOMA-IR correlated with GLP-2 AUC (R = 0.504; p = 0.012), and OGIS correlated with GLP-2 incremental AUC (R = -0.54; p = 0.054). The correlation persisted after controlling for BMI. CONCLUSION: We found an association of GLP-2 secretion and insulin resistance (IR). The understanding of the underlying mechanisms may provide future directions in the pharmacological manipulation of incretins, and in the treatment of obesity and related metabolic disorders.