Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event

Background:. Although the role of the lung alveolar macrophage (AM) as a mediator of acute lung injury (ALI) after lung ischemia/reperfusion (I/R) has been suggested by animal experiments, it has not been determined whether AMs mediate ALI after intestinal I/R. The objective of this study was to determine the effect of AM elimination on ALI after intestinal I/R in rats. Mwthods: Male Wistar rats (n = 90) were randomly divided into three groups: the clodronate-liposomes (CLOD-LIP) group received intratracheal treatment with CLOD-LIP; the liposomes (LIP) group received intratracheal treatment with LIP; and the nontreated (UNTREAT) group received no treatment. Twenty-four hours later each group was randomly divided into three subgroups: the intestinal I/R subgroup was subjected to 45-minute intestinal ischemia and 2-hour reperfusion; the laparotomy (LAP) subgroup was subjected to LAP and sham procedures; the control (CTR) subgroup received no treatment. At the end of reperfusion, ALI was quantitated in all the animals by the Evans blue dye (EBD) method. Results: ALI values are expressed as EBD lung leakage (mu g EBD/g dry lung weight). EBD lung leakage values in the CLOD-LIP group were 32.59 +/- 12.74 for I/R, 27.74 +/- 7.99 for LAP, and 33.52 +/- 10.17 for CTR. In the LIP group, lung leakage values were 58.02 +/- 18.04 for I/R, 31.90 +/- 8.72 for LAP, and 27.17 +/- 11.48 for CTR. In the UNTREAT group, lung leakage values were 55.60 +/- 10.96 for I/R, 35.99 +/- 6.89 for LAP, and 30.83 +/- 8.41 for CTR. Within each group, LAP values did not differ from CTR values. However, in the LIP and UNTREAT groups, values for both the LAP and CTR subgroups were lower than values for the I/R subgroup (p < 0.001). The CLOD-LIP I/R subgroup value was less (p < 0.001) than the I/R subgroup values in the LIP and UNTREAT groups. These results indicated that I/R provokes ALI that can be prevented by CLOD-LIP treatment, and further suggested that AMs are essential for ALI occurrence induced by intestinal I/R in rats.

Use of an Inflatable Silicone Balloon Improves the Success Rate of Bladder Autoaugmentation at Long-Term Followup

Purpose: Most groups have reported disappointing results with autoaugmentation or detrusor myectomy for low capacity/compliance neuropathic bladders. Failure may be due to an ischemic diverticulum or mucosal shrinkage. We investigated whether a Silimed (R) silicone balloon placed in the bladder after autoaugmentation could prevent these problems, improving surgical results. Materials and Methods: We compared the results of standard bladder autoaugmentation in 12 children (group 1) with those in 10 (group 2) who underwent the same surgery using a bladder conformer. The conformer was a silicone balloon filled with saline that remained in the bladder for 2 weeks. All patients had a neuropathic bladder with poor capacity and compliance, resulting in urinary leakage between catheterizations. Preoperative and postoperative evaluation included a voiding diary, ultrasound, voiding cystourethrogram and urodynamics. Results: In group 1 only 1 patient became dry, 4 had little improvement in continence, 4 remained unchanged and 3 became worse. In group 2, 6 patients (60%) become continent without medication, 2 (20%) become continent with oxybutynin and 2 remained unchanged. Bladder capacity and compliance did not change significantly in group 1. However, in group 2 capacity changed from a mean of 140 to 240 ml and mean +/- SD compliance increased from 15.6 +/- 16.8 to 34.3 +/- 22.8 ml/cm H(2)O (p = 0.02). Conclusions: The inflatable balloon improved our long-term results of bladder auto-augmentation. A larger series may be necessary to confirm procedure efficacy and safety.

Prediction of impact forces in a vibratory ball mill using an inverse technique

To understand the dynamic mechanisms of the mechanical milling process in a vibratory mill, it is necessary to determine the characteristics of the impact forces associated with the collision events. However, it is difficult to directly measure the impact force in an operating mill. This paper describes an inverse technique for the prediction of impact forces from acceleration measurements on a vibratory ball mill. The characteristics of the vibratory mill have been investigated by the modal testing technique, and its system modes have been identified. In the modelling of the system vibration response to the impact forces, two modal equations have been used to describe the modal responses. The superposition of the modal responses gives rise to the total response of the system. A method based on an optimisation approach has been developed to predict the impact forces by minimising the difference between the measured acceleration of the vibratory ball mill and the predicted acceleration from the solution of the modal equations. The predicted and measured impact forces are in good agreement. Copyright (C) 1996 Elsevier Science Ltd.

Intralesional pentoxifylline as an adjuvant treatment for perioral post-burn hypertrophic scars

Pentoxifylline (PTF), a methylxanthine derivative, has therapeutic use as an antifibrotic agent. In vitro, PTF inhibits the production of collagen and reduces the proliferation of fibroblasts in hypertrophic scars. This study aimed to evaluate changes in the elasticity of hypertrophic scars in the peribuccal area in burned patients, who presented with mouth-opening limitation. Eighteen patients were divided into two groups. The case group (n = 10) was treated with PTF 1 mg ml(-1), while in the control group (n = 8) no treatment was performed. Measurements of mouth opening (lip-to-lip and tooth-to-tooth distances in mm) were taken, before and after five therapeutic sessions with pentoxifylline with weekly intervals. The variations of these measures (Delta%) were calculated and submitted to statistical analyses. There was a significant improvement in the opening of the mouth, in vermilion distance (V = 3.20 mm) as much as the dental distance (DD = 4.19 mm) in the treated group, than in the control group. It was noted that pentoxifylline increases the elasticity of hypertrophic scars in the perioral area. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Reliability of multiple frequency bioelectrical impedance analysis: An intermachine comparison

The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Laparoscopic extended cardiomyotomy in children: an effective procedure for the treatment of esophageal achalasia

Purpose: Achalasia of the esophagus is characterized by aperistalsis and incomplete relaxation of the lower esophageal sphincter in response to swallowing. The objective of the present study is to present the experience of a modified Heller myotomy via a laparoscopic approach for the treatment of children who had this condition. Methods: A retrospective review of medical records of all patients who underwent this procedure from 2000 to 2009 was performed. The procedure consisted of an extended esophagomyotomy beginning on the lower part of the lower esophageal sphincter and continuing 5 to 6 cm above on the lower third of the esophagus, and then extended 3 to 4 cm below to the stomach, associated with an anterior 180-degree hemi-fundoplication according to Dor`s technique. Results: Fifteen patients were included in the study. There were 8 female and 7 male patients. Mean operating time was 190 minutes with no intraoperative complications and 1 conversion to open surgery because of difficulty in dissecting an inflamed distal esophagus. In a mean follow-up period of 32.3 months, 2 patients had recurrence of mild dysphagia that disappeared spontaneously, and 1 required a single botulinum toxin injection with complete resolution of symptoms. Conclusion: We conclude that the laparoscopic extended Heller myotomy with Dor fundoplication is a safe and effective method for the treatment for achalasia in the pediatric population even in advanced cases. (C) 2010 Elsevier Inc. All rights reserved.

Low Hematocrit Levels Increase Intracranial Pressure in an Animal Model of Cryogenic Brain Injury

Background: Brain injury is responsible for significant morbidity and mortality in trauma patients, but controversy still exists over optimal fluid management for these patients. This study aimed to investigate the effects of acute hemodilution with hydroxyethyl starch (HES) or lactated Ringer`s solution (LR) in intracranial pressure (ICP) and cerebral perfusion pressure (CPP) in dogs submitted to a cryogenic brain injury model. Methods: Design-Prospective laboratory animal study. Setting-Research laboratory in a teaching hospital. Subjects-Thirty-five male mongrel dogs. Interventions-Animals were enrolled to five groups: control, hemodilution with LR or HES 6% to an hematocrit target of 27% or 35%. Results: ICP and CPP levels were measured after cryogenic brain injury. Hemodilution promotes an increment of ICP levels, which decreases CPP when hematocrit target was estimated in 27.% after hemodilution. However, no differences were observed regarding crystalloid or colloid solution used for hemodilution in ICP and CPP levels. Conclusions: Hemodilution to a low hematocrit level increases ICP and decreases CPP scores in dogs submitted to a cryogenic brain injury. These results suggest that excessive hemodilution to a hematocrit below 30% should be avoided in traumatic brain injury patients.

The Role of Prostate Specific Membrane Antigen and Pepsinogen C Tissue Expression as an Adjunctive Method to Prostate Cancer Diagnosis

Purpose: The diagnosis of prostate cancer in men with persistently increased prostate specific antigen after a negative prostate biopsy has become a great challenge for urologists and pathologists. We analyzed the diagnostic value of 6 genes in the tissue of patients with prostate cancer. Materials and Methods: The study was comprised of 50 patients with localized disease who underwent radical prostatectomy. Gene selection was based on a previous microarray analysis. Among 4,147 genes with different expressions between 2 pools of patients 6 genes (PSMA, TMEFF2, GREB1, TH1L, IgH3 and PGC) were selected. These genes were tested for diagnostic value using the quantitative reverse transcription polymerase chain reaction method. Initially malignant tissue samples from 33 patients were analyzed and in the second part of the study we analyzed benign tissue samples from the other 17 patients with prostate cancer. The control group was comprised of tissue samples of patients with benign prostatic hyperplasia. Results: Analysis of malignant prostatic tissue demonstrated that prostate specific membrane antigen was over expressed (mean 9 times) and pepsinogen C was under expressed (mean 1.3 X 10(-4) times) in all cases compared to benign prostatic hyperplasia. The other 4 tested genes showed a variable expression pattern not allowing for differentiation between benign and malignant cases. When we tested these results in the benign prostate tissues from patients with cancer, pepsinogen C maintained the expression pattern. In terms of prostate specific membrane antigen, despite over expression in most cases (mean 12 times), 2 cases (12%) presented with under expression. Conclusions: Pepsinogen C tissue expression may constitute a powerful adjunctive method to prostate biopsy in the diagnosis of prostate cancer cases.

Is PHEEM a multi-dimensional instrument? An international perspective

Aim: To look at the characteristics of Postgraduate Hospital Educational Environment Measure (PHEEM) using data from the UK, Brazil, Chile and the Netherlands, and to examine the reliability and characteristics of PHEEM, especially how the three PHEEM subscales fitted with factors derived statistically from the data sets. Methods: Statistical analysis of PHEEM scores from 1563 sets of data, using reliability analysis, exploratory factor analysis and correlations of factors derived with the three defined PHEEM subscales. Results: PHEEM was very reliable with an overall Cronbach`s alpha of 0.928. Three factors were derived by exploratory factor analysis. Factor One correlated most strongly with the teaching subscale (R=0.802), Factor Two correlated most strongly with the role autonomy subscale (R=0.623) and Factor Three correlated most strongly with the social support subscale (R=0.538). Conclusions: PHEEM is a multi-dimensional instrument. Overall, it is very reliable. There is a good fit of the three defined subscales, derived by qualitative methods, with the three principal factors derived from the data by exploratory factor analysis.

An analysis of valve re-replacement after aortic valve replacement with biologic devices

Biologic valve re-replacement was examined in a series of 1343 patients who underwent aortic valve replacement at The Prince Charles Hospital, Brisbane, with a cryopreserved or 4 degrees C stored allograft valve or a xenograft valve, A parametric model approach was used to simultaneously model the competing risks of death without re-replacement and re-replacement before death, One hundred eleven patients underwent a first re-replacement for a variety of reasons (69 patients with xenograft valves, 28 patients with 4 degrees C stored allograft valves, and 14 patients with cryopreserved allograft valves), By multivariable analysis younger age at operation was associated with xenograft, 4 degrees C stored allograft, and cryopreserved allograft valve re-replacement, However, this effect was examined in the context of longer survival of younger patients, which increases their exposure to the risk of re-replacement as compared with that in older patients whose decreased survival reduced their probability of requiring valve re-replacement, In patients older than 60 years at the time of aortic valve replacement, the probability of re-replacement (for any reason) before death was similar for xenografts and cryopreserved allograft valves but higher for 4 degrees C stored valves, However, in patients younger than 60 years, the probability of re-replacement at any time during the remainder of the life of the patient was lower with the cryopreserved allograft valve compared with the xenograft valve and 4 degrees C stored allografts.

Protein disulfide isomerase redox-dependent association with p47(phox): evidence for an organizer role in leukocyte NADPH oxidase activation

Mechanisms of leukocyte NADPH oxidase regulation remain actively investigated. We showed previously that vascular and macrophage oxidase complexes are regulated by the associated redox chaperone PDI. Here, we investigated the occurrence and possible underlying mechanisms of PDI-mediated regulation of neutrophil NADPH oxidase. In a semirecombinant cell-free system, PDI inhibitors scrRNase (100 mu g/mL) or bacitracin (1 mM) near totally suppressed superoxide generation. Exogenously incubated, oxidized PDI increased (by similar to 40%), whereas PDIred diminished (by similar to 60%) superoxide generation. No change occurred after incubation with PDI serine-mutated in all four redox cysteines. Moreover, a mimetic CxxC PDI inhibited superoxide production by similar to 70%. Thus, oxidized PDI supports, whereas reduced PDI down-regulates, intrinsic membrane NADPH oxidase complex activity. In whole neutrophils, immunoprecipitation and colocalization experiments demonstrated PDI association with membrane complex subunits and prominent thiol-mediated interaction with p47(phox) in the cytosol fraction. Upon PMA stimulation, PDI was mobilized from azurophilic granules to cytosol but did not further accumulate in membranes, contrarily to p47(phox). PDI-p47(phox) association in cytosol increased concomitantly to opposite redox switches of both proteins; there was marked reductive shift of cytosol PDI and maintainance of predominantly oxidized PDI in the membrane. Pulldown assays further indicated predominant association between PDIred and p47(phox) in cytosol. Incubation of purified PDI (> 80% reduced) and p47(phox) in vitro promoted their arachidonate-dependent association. Such PDI behavior is consistent with a novel cytosolic regulatory loop for oxidase complex (re) cycling. Altogether, PDI seems to exhibit a supportive effect on NADPH oxidase activity by acting as a redox-dependent enzyme complex organizer. J. Leukoc. Biol. 90: 799-810; 2011.

Influence of Estrogen Deficiency on Bone Around Osseointegrated Dental Implants: An Experimental Study in the Rat Jaw Model

Purpose: The aim of this study was to evaluate the influence of estrogen deficiency on bone around osseointegrated dental implants in a rat jaw model. Materials and Methods: This study used 16 female rats that had the first molars bilaterally extracted and were allowed to heal for 30 days before implant placement. Sixty days after implant placement, the animals were randomly subjected to sham surgery or ovariectomy (OVX). The animals were euthanized 90 days after OVX. Bone-to-implant contact, bone area fraction occupancy between implant threads, mineral density, turnover markers, and cells positive for tartrate-resistant acid phosphatase were assessed for the 2 groups. Results: The results showed that OVX group presented a decrease of systemic bone density, alterations in bone turnover markers, and an increase of cells positive for tartrate-resistant acid phosphatase compared with the sham-surgery group. However, no difference relative to bone-to-implant contact and bone area fraction occupancy was observed between groups. Conclusions: The findings of this study demonstrate that estrogen deficiency may not be considered a risk factor for osseointegrated implant failure in jaw bone. (C) 2011 American Association of Oral and Maxillofacial Surgeons J Oral Maxillofac Surg 69:1911-1918, 2011

Induction of metamorphosis with potassium ions requires development of competence and an anterior signalling centre in the ascidian Herdmania momus

Increased Kt concentration in seawater induces metamorphosis in the ascidian Herdmania momus. Larvae cultivated at 24 degrees C exhibit highest rates of metamorphosis when treated with 40 mM KCl-elevated seawater at 21 degrees C. At 24 degrees C, H. momus larvae develop competence to respond to KCl-seawater and initiate metamorphosis approximately 3 h after hatching. Larval trunks and tails separated from the anterior papillae region, but maintained in a common tunic at a distance of greater than 60 mu m, do not undergo metamorphosis when treated with KCl-seawater; normal muscle degradation does not occur in separated tails while ampullae develop from papillae-containing anterior fragments. Normal programmed degradation of myofibrils occurs when posterior fragments are fused to papillae-containing anterior fragments. These data indicate that H. momus settlement and metamorphosis only occurs when larvae have attained competence, and suggest that an anterior signalling centre is stimulated to release a factor that induces metamorphosis.

Race modeling: An effective cognitive strategy for the 100 m sprinter?

The purpose of this study was to investigate the effects of a specific cognitive race plan on 100 m sprint performance, Twelve elite sprinters (11 male and 1 female) performed 100 m time trials under normal (control) conditions and then under experimental conditions (use of race cues). In the experimental condition, participants were asked to think about specific thought content in each of three segments of the 100 m. A multiple baseline design was employed. A mean improvement of 0.26 s was found. Eleven of the 12 participants showed improvement using the specific cognitive race plan (p < .005). Participants also produced more consistent sprint performances when using the cues (p < .01). Subjective evaluations made by the participants unanimously supported the use of the race plan for optimizing sprint performance. Environmental conditions, effort, and practice effects were considered as possible influences on the results.